This page has been archived and is no longer updated
Generation of germline-competent induced pluripotent stem cells
Author: K. Okito
Keywords
Keywords for this Article
Add keywords to your Content
Save
|
Cancel
Share
|
Cancel
Revoke
|
Cancel
Rate & Certify
Rate Me...
Rate Me
!
Comment
Save
|
Cancel
Flag Inappropriate
The Content is
Objectionable
Explicit
Offensive
Inaccurate
Comment
Flag Content
|
Cancel
Delete Content
Reason
Delete
|
Cancel
Close
Full Screen
"ARTICLES Generation of germline-competent induced pluripotent stem cells Keisuke Okita 1 , Tomoko Ichisaka 1,2 & Shinya Yamanaka 1,2 We have previously shown that pluripotent stem cells can be induced from mouse fibroblasts by retroviral introduction of Oct3/4(alsocalledPou5f1),Sox2,c-MycandKlf4,andsubsequentselectionforFbx15(alsocalledFbxo15)expression.These inducedpluripotentstem(iPS)cells(hereaftercalledFbx15iPScells)aresimilartoembryonicstem(ES)cellsinmorphology, proliferation and teratoma formation; however, they are different with regards to gene expression and DNA methylation patterns, and fail to produce adult chimaeras. Here we show that selection for Nanog expression results in germline-competent iPS cells with increased ES-cell-like gene expression and DNA methylation patterns compared with Fbx15 iPS cells. The four transgenes (Oct3/4, Sox2, c-myc and Klf4) were strongly silenced in Nanog iPS cells. We obtained adult chimaeras from seven Nanog iPS cell clones, with one clone being transmitted through the germ line to the next generation. Approximately 20% of the offspring developed tumours attributable to reactivation of the c-myc transgene. Thus, iPS cells competent for germline chimaeras can be obtained from fibroblasts, but retroviral introduction of c-Myc should be avoided for clinical application. AlthoughEScellsarepromisingdonorsourcesincelltransplantation therapies 1 , they face immune rejection after transplantation and there are ethical issues regarding the usage of human embryos. These concerns may be overcome if pluripotent stem cells can be directly derived from patients? somatic cells 2 . We have previously shown that iPS cells can be generated from mouse fibroblasts by retrovirus-mediated introduction of four transcription factors (Oct3/4 (refs 3, 4), Sox2 (ref. 5), c-Myc (ref. 6) and Klf4 (ref. 7)) andbyselectionforFbx15expression 8 .Fbx15iPScells,however,have different gene expression and DNA methylation patterns compared with EScells anddonot contribute toadultchimaeras. Weproposed thattheincompletereprogrammingmightbeduetotheselectionfor Fbx15 expression, and that by using better selection markers, we might be able to generate more ES-cell-like iPS cells. We decided to use Nanog as a candidate of such markers. Although both Fbx15 and Nanog are targets of Oct3/4 and Sox2 (refs 9?11), Nanog is more tightly associated with pluripotency. In contrast to Fbx15-null mice and ES cells that barely show abnormal phenotypes 9 , disruption of Nanog in mice results in loss of the plur- ipotent epiblast 12 . Nanog-null ES cells can be established, but they tend to differentiate spontaneously 12 . Forced expression of Nanog renders ES cells independent of leukaemia inhibitory factor (LIF) for self-renewal 12,13 and confers increased reprogramming efficiency after fusion with somatic cells 14 . These results prompted us to pro- pose that if we use Nanog as a selection marker, we might be able to obtain iPS cells displaying a greater similarity to ES cells. Generation of Nanog iPS cells To establish a selection system for Nanog expression, we began by isolating a bacterial artificial chromosome (BAC, ,200kilobases) containing the mouse Nanog gene in its centre. By using recombi- neering technology 15,16 , we inserted a green fluorescent protein (GFP)-internal ribosome entry site (IRES)-puromycin resistance gene (Puro r ) cassette into the 59 untranslated region (UTR; Fig. 1a). ES cells that hadstably incorporated the modifiedBAC were positive for GFP, but became negative when differentiation was induced (not shown). By introducing these ES cells into blastocysts, we obtained chimaeric mice and then transgenic mice containing the Nanog- GFP-IRES-Puro r reporterconstruct.Intransgenicmouseblastocysts, GFP was specifically observed in the inner cell mass (Fig. 1b). In 9.5days post coitum (d.p.c.) embryos, only migrating primordial germ cells (PGCs) showed GFP signal. In 13.5d.p.c. embryos, GFP was specifically detected in the genital ridges of both sexes. After removing the brain, visceral tissues and genital ridges, we isolated mouseembryonicfibroblasts(MEFs)from13.5d.p.c.maleembryos. Flow cytometry analyses showed that these MEFs did not contain GFP-positive cells, whereas,1% of cells isolated from genital ridges showed GFP signals (Fig. 1c). Next, we introducedthefour previously described factors (Oct3/4, Sox2, Klf4 and the c-Myc mutant c-Myc(T58A)) into Nanog-GFP- IRES-Puro r MEFs cultured on SNL feeder cells with the use of retro- viral vectors. Three, five, or sevendays after retroviral infection, we startedpuromycinselectioninEScellmedium.GFP-positivecellsfirst became apparent,7days after infection. Twelvedays after infection, afewhundredcoloniesappeared,regardlessofthetimingofpuromy- cin selection (Fig. 2a). By contrast, no colonies emerged from MEFs transfected with mock DNA. Among puromycin-resistant colonies, ,5% were positive for GFP (Fig. 2b). When the puromycin selection was started at 7days after infection, we obtained the most GFP- positive colonies. Because we used the GFP-IRES-Puro r cassette, it is unclear why we obtained GFP-negative colonies. With increased concentrations of puromycin, we obtained fewer GFP-negative col- onies (Fig. 2c). With any combination of three of the four factors, we did not obtain any GFP-positive colonies (Supplementary Fig. 1). By continuing cultivation of these GFP-positive colonies, we obtained cells that were morphologically indistinguishable from ES cells (Fig. 2d). These cells also demonstrated ES-like proliferation, with slightly longer doubling times than that of ES cells (Fig. 3a). Subcutaneous transplantation of these cells into nude mice resulted in tumours that consisted of various tissues of all three germ layers, 1 DepartmentofStemCellBiology,InstituteforFrontierMedicalSciences,KyotoUniversity,Kyoto606-8507,Japan. 2 CREST,JapanScienceandTechnologyAgency,Kawaguchi332- 0012, Japan. Vol 448|19 July 2007|doi:10.1038/nature05934 313 Nature �2007 Publishing Group indicatingthatthesecellsarepluripotent(Fig.3bandSupplementary Fig. 2). We therefore refer to these cells as Nanog iPS cells in the remainder of this manuscript. Induced pluripotent stem cells were established from Fbx15 b-geo MEFs in parallel and are referred to as Fbx15 iPS cells. Similarity between Nanog iPS cells and ES cells Polymerase chain reaction with reverse transcription (RT?PCR) showed that Nanog iPS cells expressed most ES cell marker genes, includingNanog,athigherandmoreconsistentlevelscomparedwith Fbx15 iPS cells (Fig. 4a). DNA microarray analyses confirmed that Nanog iPS cells had greater ES-cell-like gene expression compared withFbx15iPScells(Fig.4b).TheexpressionlevelofRex1(alsocalled Zfp42) in Nanog iPS cells was higher compared with Fbx15 iPS cells, but still lower than in ES cells. Thus, Nanog iPS cells show greater gene expression similarity to ES cells (without being identical) than do Fbx15 iPS cells. RT?PCR showed that Nanog iPS cells have significantly lower expression levels of the four transgenes than Fbx15 iPS cells (Fig. 4c). Real-time PCR confirmed that transgene expression was very low in Nanog iPS cells (Supplementary Fig. 4a?d). In contrast, Southern blot analyses showed similar copy numbers of retroviral integration in Nanog iPS cells and Fbx15 iPS cells (Supplementary Fig. 5). These data indicate that retroviral transgene expression is largely silenced in Nanog iPS cells, as has been shown in ES cells 17 . The expression levels of the transgenes are reversely correlated with Dnmt3a2 expression, suggesting that de novo methyltransferase 18 may be involved in the retroviral silencing observed in iPS cells (Supplementary Fig. 6). Bisulphite genomic sequencing analyses also revealed similarities between Nanog iPS cells and ES cells (Fig. 5). The promoter regions of Nanog, Oct3/4 and Fbx15 were largely unmethylated in Nanog iPS cells. This is in marked contrast to Fbx15 iPS cells in which the promoters of Nanog and Oct3/4 were only partially unmethylated 8 . Differentially methylated regions of imprinting genes H19 and Igf2r were partially methylated in Nanog iPS cells. During PGC develop- ment,imprintingiserasedby12.5d.p.c. 19?21 .Thelossofimprintingis maintained in embryonic germ cells derived from 12.5d.p.c. PGCs 22 andclonedembryosderivedfrom12.5?16.5d.p.c.PGCs 23,24 .EScells, by contrast, showed normal imprinting patterns 25 . Thus, Nanog iPS cellsshowgreatersimilarityinthemethylationpatternsofimprinting genes to ES cells than to embryonic germ cells. Simple sequence length polymorphism (SSLP) analyses showed that Nanog iPS cells are largely of theDBAbackground but also have some contribution from the C57BL/6 and 129S4 backgrounds (Supplementary Fig. 3). This result is consistent with the genetic background of the MEFs, which was 75% DBA, 12.5% C57BL/6 3 days 5 days 7 days 0 7 days a bc 1.5 2.0 2.5 1.0 d Puromycin selection (1 �g ml ?1 ) Control Nanog Fbx15 7 / 387 7 / 346 23 / 457 Puro (�g ml ?1 ) Colony 6/180 4/45 2/2 0/0 Figure 2 | Generation of iPS cells from MEFs of Nanog-GFP-IRES-Puro r transgenicmice. a, Puromycin-resistant colonies. Puromycin selection was initiated at 3, 5, or 7 days after retroviral transduction. Numbers indicate GFP-positive colonies/total colonies. b, GFP fluorescence in resulting colonies. Phase contrast (top row) and fluorescence (bottom row) micrographs are shown. iPS cells were also generated from Fbx15-bgeo knockin MEFs. c, Effect of increasing concentrations of puromycin. Numbers of GFP-positive colonies/total colonies are shown on the right. d, Morphologyof establishedNanogiPScells(clone20D17).Phasecontrast (left) and fluorescence (right) micrographs are shown. a b Blastocyst 9.5 d.p.c. 13.5 d.p.c. GFP c Genital ridge MEFs ? ? Nanog BAC 80 kb 125 kb GFP IRES Puro r pA 141 cells/1 x 10 4 cells 0 cells/2 x 10 5 cells Autofluorescence Figure 1 | Nanog-GFP-IRES-Puro r transgenic mice. a, Modified BAC construct. White boxes indicate the 59 and 39 UTRs of the mouse Nanog gene. Black boxes indicate the open reading frame. b, GFP expression in Nanog-GFP transgenic mouse embryos. Whole embryos (top panels) and isolated genital ridges (bottom panels) from 13.5d.p.c. mice are shown. c, Histogram showing GFP fluorescence in cells isolated from genital ridges of a 13.5d.p.c. Nanog-GFP transgenic mouse embryo (left) or in MEFs isolated from the same embryo (right). ARTICLES NATURE|Vol 448|19 July 2007 314 Nature �2007 Publishing Group and 12.5% 129S4. This result also confirms that Nanog iPS cells are not a contamination of ES cells that exists in our laboratory, which are either pure 129S4 or C57BL/6. We next compared the stability of Nanog iPS cells and Fbx15 iPS cells (Supplementary Fig. 7). Cells were cultivated in the presence of the selection drug for up to 22?26 passages. Morphologically, we did not observe significant changes over the long-term culture course. However,RT?PCRshowedthatFbx15iPScellslosttheexpressionof ES cell marker genes after prolonged culture. By contrast, Nanog iPS cellsmaintainedrelativelyhighexpressionlevelsoftheEScellmarker genes. These data demonstrate that Nanog iPS cells are more stable than Fbx15 iPS cells. We also compared the induction efficiency of Nanog iPS cells and Fbx15 iPS cells. In independent experiments, we obtained 4?125 GFP-positive colonies from 8310 5 Nanog-reporter MEFs trans- fected with the four transcription factors. Because ,50% of trans- fected MEFs are supposed to express all four factors 8 , the induction efficiency is approximately 0.001?0.03%. In contrast, from the same number of Fbx15-reporter MEFs, we obtained 47?1,800 G418-resistant colonies, with the induction efficiency of approxi- mately 0.01?0.5%. Thus, the efficiency of Nanog iPS cell induction is approximately one-tenth that of Fbx15 iPS cells. WethencomparedtheresponsesofNanogiPScellsandFbx15iPS cells to LIF or retinoic acid (Supplementary Fig. 8). As we have shown previously 8 , Fbx15 iPS cells do not remain undifferentiated when cultured without feeder cells, even in the presence of LIF. Furthermore, Fbx15 iPS cells formed compact colonies when cultured without feeder cells in the presence of retinoic acid. In contrast,LIFmaintainedtheundifferentiatedstateofNanogiPScells cultured without feeder cells. Retinoic acid induced the differenti- ation of Nanog iPS cells. Thus, Nanog iPS cells are similar to ES cells in their response to LIF and retinoic acid. Initially we used the T58A mutant of c-Myc to induce Nanog iPS cells. We also tested wild-type c-Myc for Nanog iPS cell induction. Weobtainedasimilarnumberofcolonieswithbothwild-typec-Myc and the T58A mutant. Nanog iPS cells established with wild-type c-Myc were indistinguishable from those established with the T58A mutant with regards to morphology, gene expression (analysed via microarrays), teratoma formation (Supplementary Fig. 2) and stability under puromycin selection (Supplementary Fig. 9). With- out puromycin selection, Nanog iPS cells induced by wild-type c-Myc were more stable (Supplementary Fig. 9). 03 96121518 6 8 10 14 12 ES Nanog iPS 20D17 (p8) a b Cell number (log 10 ) Days Nanog iPS (20D16, 20D17, 20D18) 21.7 h Fbx15 iPS (10,15) 24.6 h ES 16.8 h Figure 3 | Characterization of Nanog iPS cells. a, Proliferation. ES cells, Nanog iPS cells (clones 20D16, 20D17 and 20D18) and Fbx15 iPS cells (clones10and15)werepassagedevery3days(3310 5 cellspereachwellofa 6-wellplate).Calculateddoublingtimesareindicated.b,Teratomas.EScells or Nanog iPS cells (clone 20D17, 1310 6 cells) were subcutaneously transplanted into nude mice. After 8weeks, teratomas were photographed (left) and analysed histologically with haematoxylin and eosin staining (right). b ESES Rex1 Rex1 Nanog Nanog Gapdh Eras 1 -2 -6 -16 -17 -18 4 5 10 15 16 S E1 Nanog iPS Fbx15 iPS Nanog GFP Fbx15 p53 Esg1 Rex1 20D - a Oct3/4 Sox2 Klf4 Total Endo. tg Total Endo. tg Total Endo. tg Total Endo. tg c-myc c MEFs No template 1 -2 -6 -16 -17 -18 4 5 10 15 16 ES1 Nanog iPS Fbx15 iPS 20D - MEF s No templat e Fbx15 iPS Nanog iPS Figure 4 | Gene expression in Nanog iPS cells. a, RT?PCR. Total RNA was isolated from six clones of Nanog iPS cells (clones 20D1, 20D2, 20D6, 20D16,20D17and20D18),sixclonesofFbx15iPScells(clones1,4,5,10,15 and 16), MEFs and ES cells. b, Scatter plots showing comparison of global geneexpressionbetweenEScellsandNanogiPScells(right),andbetweenES cells and Fbx15 iPS cells (left), as determined by DNA microarrays. c,Expressionlevelsofthefourtranscriptionfactors.TotalRNAwasisolated fromsixclonesofNanogiPScells(clones20D1,20D2,20D6,20D16,20D17 and20D18),sixclonesofFbx15iPScells(clones1,4,5,10,15and16),MEFs and ES cells. RT?PCR analyses were performed with primers that amplified the coding regions of the four factors (Total), endogenous transcripts only (Endo.), and transgene transcripts only (tg). NATURE|Vol 448|19 July 2007 ARTICLES 315 Nature �2007 Publishing Group Germline chimaeras from Nanog iPS cells We next examined the ability of Nanog iPS cells to produce adult chimaeras. We injected 15?20 male Nanog iPS cells (five clones with the T58A mutant and three with wild-type c-Myc) into C57BL/6- derived blastocysts, which we then transplanted into the uteri of pseudo-pregnant mice. We obtained adult chimaeras from seven clones (four clones with the T58A mutant and three with wild-type c-Myc) as determined by coat colour (Fig. 6a and Supplementary Table 1). SSLP analyses showed that Nanog iPS cells contributed to various organs, with the level of chimaerism ranging from 10% to 90%. Chimeras from clone 20D17 showed highest iPS cell contri- bution in the testes. From clone 20D18, we obtained only a few non- chimaeric pups from infected blastocysts; thus, whether this clone hascompetencyforproducingadultchimaerasremainedtobedeter- mined.ThesedatademonstratethatmostNanogiPSclonesarecom- petent for adult chimaeric mice. We then crossed three of the chimaeras from clone 20D17?for which the highest iPS cell contribution was in the testes?with C57BL/6 females. Whereas all F 1 mice showed black coat colour, all contained retroviral integration of the four transcription factors and approximately halfcontained theGFP-IRES-Puro r cassette(Fig.6b), indicating germline transmission. Furthermore, approximately half of the F 2 mice born from F 1 intercrosses showed agouti coat colour, confirming germline transmission of Nanog-iPS-20D17 (Fig. 6c). We also examined germline competency for two other clones that producedadultchimaeras.InonechimaericmousefromNanog-iPS- 38C2 cell line, PCR analysis detected iPS cell contribution in isolated spermatozoa (Fig. 6d), suggesting that germline competency is not confined to clone 20D17. However, the iPS cell contribution to sperm of clone 38C2 is much smaller than that of clone 20D17, andnoiPS-cell-derivedoffspringwerefoundfor119micebornfrom the cross between the 38C2 chimaera and C57BL/6 female mice. Most male mice with a high degree of chimaerism from the Nanog-iPS-38D2 cell line showed small testes and aspermatogenesis (Supplementary Fig. 13). The testes of some chimaeras from Nanog- iPS-38D2 contained mature sperm, but no iPS cell contribution was detected by PCR (Fig. 6d). Tumour formation by c-myc reactivation Out of 121 F 1 mice (aged 8?41weeks) derived from the Nanog-iPS- 20D17 cell line, 24died or were killed because of weakness, wheezing or paralysis. Necropsy of 17 mice identified neck tumours (Sup- plementary Fig. 10) in 13 mice and other tumours in five mice, including two mice with neck tumours. Histological examination of one neck tumour showed that it was a ganglioneuroblastoma with follicular carcinoma of the thyroid gland (not shown). In these tumours, retroviral expression of c-myc, but not Oct3/4, Sox2,or Klf4, is reactivated (Supplementary Fig. 11). In contrast, transgene expression of all four transcription factors remained low in normal tissues,exceptforc-mycinmuscleinonemouse(SupplementaryFig. 12).Thesedataindicatethatreactivationofc-mycretrovirusisattrib- utable to tumour formation. Discussion Our results demonstrate that Nanog selection allows the generation of high-quality iPS cells that are comparable to ES cells in morpho- logy, proliferation, teratoma formation, gene expression and com- petency for adult chimaeras. Nearly all Nanog iPS clones showed these properties, indicating that Nanog is a major determinant of quality in cellular pluripotency. However, germline competence was variable among Nanog iPS clones, indicating the existence of other important determinants of germline competency in addition to Nanog. The high quality of Nanog iPS cells underscores the possibility of using this technology to generate patient-specific plur- ipotent stem cells. In a separate study, we found that germline- competent iPS cells can also be obtained from adult mouse somatic cells(T.AoiandS.Y.,unpublisheddata).Thecurrentstudy,however, alsorevealsthatreactivationofc-mycretrovirusmayresultintumour formation. There may be ways to overcome this problem. Strong silencing of the four retroviruses in Nanog iPS cells indicates that they are only required for the induction, but not the maintenance, of pluripotency. Therefore, the retrovirus-mediated system might be Nanog iPS 20D17 Nanog iPS 20D18 ES MEFs Oct3/4 Nanog Fbx15 H19 Igf2r Figure 5 | DNAmethylationofES-cell-specificgenesandimprintinggenes. White circles indicate unmethylated CpG dinucleotides, whereas black circles indicate methylated CpG dinucleotides. GFP Oct3/4 tg Klf4 tg S P i ?? Offspring ???? ? n i a r B t r a e H g n u L r e v i L h c a m o t S n e e l p S y e n d i K d a n o G n i k S e l c s u M 20D17 38C2 38D2 C57BL/6 DBA (iPS) a b c d 7 1 D 0 2 2 C 8 3 2 D 8 3 C57BL/6 DBA (iPS) WT Figure 6 | Germlinechimaeras from NanogiPS cells. a, Tissue distribution of iPS cells in chimaeras. Genomic DNA was isolated from the indicated organs of chimaeras derived from threeNanog iPS cell clones (20D17, 38C2 and 38D2). SSLP analyses were performed for D6Mit15. b, PCR analyses showingthepresenceoftheGFPcassetteandretroviraltransgenesinF 1 mice obtained from the intercross between a chimaeric male and a C57BL/6 female. c, Coat colours of F 2 mice obtained from F 1 intercrosses. d, Sperm contributionof iPScellsin chimaericmice.Spermatozoawereisolatedfrom theepididymidesofchimaericmicederivedfromthreeNanogiPScellclones (20D17, 38D2 and 38C2). iPS cell contribution was determined by SSLP of D6Mit15. ARTICLES NATURE|Vol 448|19 July 2007 316 Nature �2007 Publishing Group eventually replaced by transient expression, such as the adenovirus- mediated system. Alternatively, high-throughput screeningof chem- ical libraries might identify small molecules that can replace the four genes. These are crucial research areas in order to apply iPS cells to regenerative medicine. We found that the efficiency of Nanog iPS cell induction is less than 0.1%. The low efficiency suggests that the origin of iPS cells might be rare stem cells co-existing in MEF culture. Alternatively, activation of additional genes by retroviral integration might be required for iPS cell generation in addition to the four transcription factors.ThisisrelevanttothefactthatwehavebeenabletoobtainiPS cells only with retroviral transduction. Identification of such fac- tor(s) may lead to the generation of iPS cells with higher efficiency, and without the need for retroviruses. METHODS SUMMARY TogenerateNanog-reportermice,weisolatedaBACclonecontainingthemouse Nanog gene in its centre. By using the RED/ET recombination technique (Gene Bridges), we inserted a GFP-IRES-Puro r cassette into the 59 UTR of the mouse Nanog gene. We introduced the modified BAC into RF8 ES cells by electropora- tion 26 . We then microinjected transgenic ES cells into C57BL/6 blastocysts to generate Nanog-reporter mice containing the modified BAC. MEFs were iso- latedfrom13.5d.p.c.maleembryosafterremovinggenitalridges.Generationof Nanog iPS cells was performed as described 8 , except that puromycin was used instead of G418 as a selection antibiotic. Retroviruses (pMXs) were generated with Plat-E packaging cells 27 . RF8 ES cells 26 and iPS cells were cultured on SNL feeder cells 28 . Analyses of iPS cells, such as RT?PCR, real-time PCR, bisulphite genomicsequencing,SSLPanalyses,DNAmicroarrays,teratomaformation,and microinjection into C57BL/6 blastocysts, were performed as described 8 . Contribution of iPS cells in chimaeric mice was determined by PCR for the SSLP marker D6Mit15. Full Methods and any associated references are available in the online version of the paper at www.nature.com/nature. Received 6 February; accepted 22 May 2007. Published online 6 June 2007. 1. Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145?1147 (1998). 2. Hochedlinger, K. & Jaenisch, R. Nuclear reprogramming and pluripotency. Nature 441, 1061?1067 (2006). 3. Niwa, H., Miyazaki, J. & Smith, A. G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature Genet. 24, 372?376 (2000). 4. Nichols, J. et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379?391 (1998). 5. Avilion, A. A. et al. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17, 126?140 (2003). 6. Cartwright,P.etal.LIF/STAT3controlsEScellself-renewalandpluripotencybya Myc-dependent mechanism. Development 132, 885?896 (2005). 7. Li,Y.etal.MurineembryonicstemcelldifferentiationispromotedbySOCS-3and inhibited by the zinc finger transcription factor Klf4. Blood 105, 635?637 (2005). 8. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663?676 (2006). 9. Tokuzawa, Y. et al. Fbx15 is a novel target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse development. Mol. Cell. Biol. 23, 2699?2708 (2003). 10. Kuroda, T. et al. Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 25, 2475?2485 (2005). 11. Rodda, D. J. et al. Transcriptional regulation of Nanog by OCT4 and SOX2. J. Biol. Chem. 280, 24731?24737 (2005). 12. Mitsui, K. et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631?642 (2003). 13. Chambers, I. et al. Functional expression cloning of nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113, 643?655 (2003). 14. Silva, J., Chambers, I., Pollard, S. & Smith, A. Nanog promotes transfer of pluripotency after cell fusion. Nature 441, 997?1001 (2006). 15. Copeland,N.G.,Jenkins,N.A.&Court,D.L.Recombineering:apowerfulnewtool for mouse functional genomics. Nature Rev. Genet. 2, 769?779 (2001). 16. Testa, G. et al. Engineering the mouse genome with bacterial artificial chromosomes to create multipurpose alleles. Nature Biotechnol. 21, 443?447 (2003). 17. Cherry,S.R.,Biniszkiewicz,D.,vanParijs,L.,Baltimore,D.&Jaenisch,R.Retroviral expression in embryonic stem cells and hematopoietic stem cells. Mol. Cell. Biol. 20, 7419?7426 (2000). 18. Chen, T., Ueda, Y., Xie, S. & Li, E. A novel Dnmt3a isoform produced from an alternative promoter localizes to euchromatin and its expression correlates with active de novo methylation. J. Biol. Chem. 277, 38746?38754 (2002). 19. Davis, T. L., Yang, G. J., McCarrey, J. R. & Bartolomei, M. S. The H19 methylation imprint is erased and re-established differentially on the parental alleles during male germ cell development. Hum. Mol. Genet. 9, 2885?2894 (2000). 20. Sato, S., Yoshimizu, T., Sato, E. & Matsui, Y. Erasure of methylation imprinting of Igf2r during mouse primordial germ-cell development. Mol. Reprod. Dev. 65, 41?50 (2003). 21. Brandeis, M. et al. The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J. 12, 3669?3677 (1993). 22. Labosky,P.A.,Barlow,D.P.&Hogan,B.L.Mouseembryonicgerm(EG)celllines: transmission through the germline and differences in the methylation imprint of insulin-like growth factor 2receptor(Igf2r) genecompared withembryonicstem (ES) cell lines. Development 120, 3197?3204 (1994). 23. Kato, Y. et al. Developmental potential of mouse primordial germ cells. Development 126, 1823?1832 (1999). 24. Lee, J. et al. Erasing genomic imprinting memory in mouse clone embryos produced from day 11.5 primordial germ cells. Development 129, 1807?1817 (2002). 25. Geijsen, N. et al. Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, 148?154 (2004). 26. Meiner, V. L. et al. Disruption of the acyl-CoA:cholesterol acyltransferase gene in mice: evidence suggesting multiple cholesterol esterification enzymes in mammals. Proc. Natl Acad. Sci. USA 93, 14041?14046 (1996). 27. Morita, S., Kojima, T. & Kitamura, T. Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063?1066 (2000). 28. McMahon, A. P. & Bradley, A. The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62, 1073?1085 (1990). Supplementary Information is linked to the online version of the paper at www.nature.com/nature. AcknowledgementsWethankK.Takahashi,M.NakagawaandT.Aoiforscientific discussion; M. Maeda for histological analyses; M. Narita, J. Iida, H. Miyachi and S. Kitano for technical assistance; and R. Kato, R. Iyama and Y. Ohuchi for administrative assistance. We also thank T. Kitamura for Plat-E cells and pMXs retroviral vectors, and R. Farese for RF8 ES cells. This study was supported in part by a grant from the Uehara Memorial Foundation, the Program for Promotion of FundamentalStudiesinHealthSciencesofNIBIO,agrantfromtheLeadingProject of MEXT, and Grants-in-Aid for Scientific Research of JSPS and MEXT (to S.Y.). K.O. is a JSPS research fellow. Author Contributions K.O. conducted most of the experiments in this study. T.I. performed manipulation of mouse embryos to generate Nanog-GFP transgenic mice. T.I.alsomaintained themouse lines.S.Y.designedandsupervisedthestudy, and prepared the manuscript. S.Y. also performed computer analyses of DNA microarray data. Author Information The microarray data are deposited in GEO under accession number GSE7841. Reprints and permissions information is available at www.nature.com/reprints. The authors declare no competing financial interests. Correspondence and requests for materials should be addressed to S.Y. (yamanaka@frontier.kyoto-u.ac.jp). NATURE|Vol 448|19 July 2007 ARTICLES 317 Nature �2007 Publishing Group METHODS Cellculture.RF8EScells(129S4background) 26 andiPScellsweremaintainedin ES medium (DMEM containing 15% FCS, 13 NEAA, 1mM sodium pyruvate, 5.5mM 2-ME, 50unitsml 21 penicillin and 50mgml 21 streptomycin) on feeder layers of mitomycin-C-treated SNL cells into which we had stably incorporated thepuromycin-resistancegene.AsasourceofLIF,weusedconditionedmedium from Plat-E cell cultures that had been transduced with a LIF-expressing vector. Plat-E cells 27 , which were also used to produce retroviruses, were maintained in DMEMcontaining10%FCS,50unitsml 21 penicillin,50mgml 21 streptomycin, 1mgml 21 puromycin and 10mgml 21 blasticidin S. ForMEFisolation,weused13.5d.p.c.maleembryos.Aftertheremovalofthe head, visceral tissues and gonads, the remaining bodies were washed and dis- sociated with trypsin. Ten-million cells were plated on each gelatin-coated 100- mm dish and incubated at 37uC with 5% CO 2 . The next day, floating cells were removedbywashingwithPBS.Inthisstudy,MEFswereusedwithinpassage5to avoid replicative senescence. BAC modification. A mouse BAC clone containing the Nanog gene, RP23- 117I23, was purchased from BACPAC Resources. Modification of the BAC was performed using the RED/ET recombination technique (Gene Bridges), which is based on homologous recombination using inducible RecET recom- bination machinery. The reporter cassette was made by ligating a GFP-IRES- Puro r fragment with a PGK-hygro-FRT cassette (Gene Bridges) that contains a prokaryotic promoter and hygromycin-resistance gene flanked by FRT sites. HomologyarmsfortheNanog59UTRwereattachedtobothendsofthereporter cassette by PCR amplification using the following primers: BAC-NanogGFP-F (59-TTTGCATTAGACATTTAACTCTTCTTTCTATGATCTTTCCTTCTAGA- CACGCCACCATGGTGAGCAAGGGCGAG-39) and BAC-NanogR (59-GCG- AGGGAAGGGATTTCTGAAAAGGTTTTAGGCAACAACCAAAAAACTCACT- GGCAGTTTATGGCGGGCGTCCT-39). Escherichia coli carrying the BAC was transformedwithaRED/ET expression plasmid,pSC101-BAD-gbaA,andrecom- binationwiththereporter cassette wassubsequently induced.Successfully recom- binedcolonieswere identifiedbyscreeningfor hygromycin resistancefollowed by PCRanalysis toensurehomologousrecombination.The hygromycincassette was excised by transformation into a Flp-recombinase expression bacterium, 294-Flp (Gene Bridges). Establishment of Nanog-reporter mice. The modified BAC was linearized by NotI digestion, and 10 mg of the DNA was introduced into RF8 ES cells by electroporation 26 . After 2days, selection was started with 1.5mgml 21 puromy- cin. Resistant colonies were picked after 9days of selection. Four genomic inte- grated clones were used for blastocyst injection, and we established two lines of Nanog reporter mice: 2A2 and 2C1. Both mice exhibited the same expression pattern. Mice from the 2A2 line were used for iPS cell induction. iPS cell induction. iPS induction was performed as described previously 8 with some modifications. Briefly, MEFs were isolated from 13.5d.p.c. embryos from Nanog-reporter male mice (50% DBA, 25% C57BL/6 and 25% 129S4) and female wild-type mice (DBA). Plat-E cells were seeded at 8310 6 cells per 100- mm dish. On the next day, 9mg of pMXs-based retroviral vectors for Oct3/4, Sox2, Klf4,orc-Myc were independently introduced into Plat-E cells using 27ml of FuGENE 6 transfection reagent. After 24h, the medium was replaced with 10mlofDMEMcontaining10%FCS.MEFswereseededat8310 5 cellsper100- mmdishcoveredbyfeedercells.Onthenextday,virus-containingsupernatants from these Plat-E cultures were recovered and filtered through a 0.45-mm cel- lulose acetate filter. Equal volumes of the supernatants were mixed and supple- mented with polybrene at the final concentration of 4mgml 21 . MEFs were incubated in the virus/polybrene-containing supernatants for 24h. Three days after infection, the medium was changed with ES medium supplemented with LIF.ForFbx15iPScellselection,weaddedG418(GeneticinfromInvitrogen)ata final concentration of 0.3mgml 21 . For Nanog iPS cells, we added puromycin (Sigma) at a final concentration of 1.5mgml 21 , unless indicated otherwise. Established iPS cells were maintained in the presence of the corresponding selection drug. Teratoma formation, RT?PCR analysis, Bisulphite sequence and SSLP analysis were performed as previously described 8 . DNAmicroarray. TotalRNAfrom Fbx15-nullMEFs(duplicate),Fbx15-nullES cells (duplicate), Fbx15 iPS cells (clone MEF4-7 8 , duplicate), or Nanog iPS cells (clones 20D -2, 16, 17, and 18) were labelled with Cy3. Samples were hybridized to a Mouse Oligo Microarray (Agilent) according to the manufacturer?s pro- tocol. Arrays were scanned with a G2565BA Microarray Scanner System (Agilent). Data were analysed using GeneSprings GX software (Agilent). We excluded genes for which their value fluctuated more than twofold between duplicated analyses. doi:10.1038/nature05934 Nature �2007 Publishing Group "
Add Content to Group
|
Bookmark
|
Keywords
|
Flag Inappropriate
share
Close
Digg
Facebook
MySpace
Google+
Comments
Close
Please Post Your Comment
*
The Comment you have entered exceeds the maximum length.
Submit
|
Cancel
*
Required
Comments
Please Post Your Comment
No comments yet.
Save Note
Note
View
Public
Private
Friends & Groups
Friends
Groups
Save
|
Cancel
|
Delete
Please provide your notes.
Next
|
Prev
|
Close
|
Edit
|
Delete
Genetics
Gene Inheritance and Transmission
Gene Expression and Regulation
Nucleic Acid Structure and Function
Chromosomes and Cytogenetics
Evolutionary Genetics
Population and Quantitative Genetics
Genomics
Genes and Disease
Genetics and Society
Cell Biology
Cell Origins and Metabolism
Proteins and Gene Expression
Subcellular Compartments
Cell Communication
Cell Cycle and Cell Division
Scientific Communication
Career Planning
Loading ...
Scitable Chat
Register
|
Sign In
Visual Browse
Close
Comments
CloseComments
Please Post Your Comment