Dear Editor,
The Coronavirus disease 2019 (COVID-19) pandemic is one of the most serious global public health crises to date. As of July 12, 2020, more than 12.6 million cases of COVID-19 infection with 0.56 million deaths were confirmed worldwide1. Since there are no effective therapeutics to treat severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2, the causative virus of COVID-19) infection so far, the pandemic is rapidly spreading worldwide. It is urgent to develop effective therapies, not only to treat infected patients but also to control the pandemic.
Our previous studies have demonstrated that a plant microRNA, MIR2911, which is enriched in honeysuckle decoction (HD), directly targets influenza A viruses (IAV), including H1N1, H5N1, and H7N9 subtypes by binding to their mRNA and blocking protein translation. Oral administration of HD can prevent IAV infection and reduce H5N1-induced mouse death2. Subsequent studies have shown that MIR2911 also directly inhibits the replication of various viruses in addition to IAVs3,4. Upon dietary uptake, these microRNAs self-assemble into exosomes and are then secreted into the circulation and delivered into target tissues or specific cells, including the liver, lung, spleen, pancreas, and T cells5,6,7. Given the unique GC-enriched nucleotide composition of MIR2911 (GGCCGGGGGACGGACUGGGA) and after we analyzed the genome sequence of SARS-CoV-2, it is most likely that the virus genome contains MIR2911-binding sites and that MIR2911 can inhibit SARS-CoV-2 replication directly. In the present study, we assessed the inhibitory effect of absorbed MIR2911 in HD on SARS-CoV-2 replication and conducted a clinical study to investigate the efficacy of HD in COVID-19 patients.
By using bioinformatics analysis, we predicted that there are 179 putative MIR2911-binding sites in the SARS-CoV-2 genome. Twenty-eight binding sites (Supplementary Table S1) were confirmed by classic luciferase assay (Supplementary Fig. S1), which are distributed widely in the virus genome (Fig. 1a), indicating that MIR2911 may be able to inhibit the translation of almost all the proteins of SARS-CoV-2.
In order to assess the direct effect of absorbed MIR2911 on SARS-CoV-2 replication, cellular exosomes were collected from culture medium of HEK293T cells transfected with synthetic MIR2911 or control non-coding RNA (ncRNA), as similar method to previous report5 (Fig. 1b). Isolated cellular exosomes with/without MIR2911 were separately pre-incubated with 5 × 104 Vero E6 cells (ATCC-1586) in 0.25 ml cell medium for 8 h. After changing the culture medium, the cells were infected with SARS-CoV-2 (nCoV-2019BetaCoV/Wuhan/WIV04/20198) at a multiplicity of infection (MOI) of 0.01. Efficacies were evaluated by quantification of viral copy numbers in the cell supernatant via quantitative real-time RT-PCR (qRT-PCR) at 24 h post infection (p.i.) (Fig. 1b). As shown in Fig. 1c, cellular exosomal-MIR2911 at 13.2 pM concentration inhibited 93% virus replication (from 4.09 × 109 to 2.87 × 108 copies/ml), indicating that absorbed MIR2911 directly and sufficiently inhibits SARS-CoV-2 replication (Fig. 1c). Next, we assessed the inhibitory effect of absorbed MIR2911 in HD on SARS-CoV-2 replication. Since absorbed MIR2911 in HD is delivered into the lung by exosomes through circulation, isolated exosomes from 62.5 μl of donor serum before and after drinking 200 ml HD (30 g dry honeysuckle) separately were pre-incubated with 5 × 104 Vero E6 cells, as similar condition to that of cellular exosomal-MIR2911 (Fig. 1b). The MIR2911 concentration in 200 ml HD was 52.5 pM (10.5 pmol/200 ml/30 g dried honeysuckle). Serum levels of MIR2911 in three heathy receivers after drinking for 2 h were 0.42, 0.45, and 1.13 pM (Fig. 1d), which were undetectable before drinking). Exosomes (MIR2911 levels: before drinking, nondetectable; after drinking, they were 9.9, 14.4, and 19.4 amol) were pre-incubated with 5 × 104 cells (Fig. 1e, ~180 copies of MIR2911/cell). As shown in Fig. 1e, exosomes containing MIR2911 significantly inhibited virus replication (Fig. 1e). There is no difference of cell viabilities between exosomes with/without MIR2911 collected from the same donor before and after drinking HD (Supplementary Fig. S2). These results strongly suggest that MIR2911 is sufficiently absorbed by consumers drinking HD and that the absorbed MIR2911 significantly blocks SARS-CoV-2 replication.
To assess the antiviral effect of MIR2911 in HD on COVID-19 patients, we conducted a clinical study. Seventy-five moderate type COVID-19 patients who received routine antiviral therapy (RT) at Nanjing Second Hospital from January 2020 to March 2020 were enrolled in this study. Patients were divided into two groups based on additional treatment with MIR2911 in HD (MIR2911+) or traditional Chinese medicine (TCM) mixture (MIR2911–) in addition to RT. The primary endpoint was the negative conversion rate on the 7th day from the first treatment. There were 6 and 69 patients in the MIR2911+ and MIR2911– groups, respectively (Supplementary Tables S2–S4). The negative conversion rate on the 7th day in the MIR2911+ group was 83.3%, which was dramatically improved compared with that of patients treated with MIR2911– TCM (26.1%, P = 0.004) (Fig. 1g, f). The time taken to become SARS-CoV-2 PCR-negative (TTN) also favored patients treated with HD-MIR2911 (median 4.0 vs. 12.0 days, HR 0.28, 95% CI 0.12–0.67, P = 0.005) (Fig. 1g, f). The median TTN of male patients in MIR2911+ (1 case) and MIR2911– (38 cases) are 5.0 days and 11.0 days (HR 0.003, 95% CI 0.000018–0.52, P = 0.027), respectively. The median TTN of female patients in MIR2911+ (5 cases) and MIR2911– (31 cases) groups are 3.0 days and 12.0 days (HR 0.15, 95% CI 0.031–0.68, P = 0.014), respectively.
HD has been used to treat viral infections for a thousand years in China. Previous studies have demonstrated that MIR2911 (0.06–0.18 pmol/day) in 1–3 ml HD significantly inhibits influenza virus replication in 20 g mouse2. In addition to the Pharmacopoeia of the People’s Republic of China9, we chose 30 g dried honeysuckle (MIR 2911 level: 10.5 pmol) per day for use. Our results demonstrate that 30 g dried honeysuckle is safe for use (Supplementary Table S4) and has sufficient antiviral function (Fig. 1d, e). On the other hand, the data that MIR2911 (~60 fM) in exosomes significantly inhibits virus replication not only confirms the extra-high antiviral activity of MIR2911 (compared with that of remdesivir: 3.7 μM and Chloroquine: 10 μM)10 but also provides a novel strategy that using serum exosomes collected from healthy donor offers the most similar condition in vivo to assess the efficacy of potential drugs in vitro.
In summary, our results suggest that absorbed plant MIR2911 in HD inhibits SARS-CoV-2 replication and accelerates the negative conversion of infected patients. HD treatment might greatly help cure infected patients and stop the COVID-19 pandemic.
References
WHO. Coronavirus disease 2019 (COVID-19) situation report-174. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200712-covid-19-sitrep-174 (2020).
Zhou, Z. et al. Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses. Cell Res.25, 39–49 (2015).
Huang, Y. et al. Honeysuckle-derived microRNA2911 directly inhibits varicella-zoster virus replication by targeting IE62 gene. J. Neurovirol.25, 457–463 (2019).
Li, X. et al. Honeysuckle-encoded microRNA2911 inhibits Enterovirus 71 replication via targeting VP1 gene. Antivir. Res.152, 117–123 (2018).
Zhang, L. et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Res.22, 107–126 (2012).
Zhao, C., Sun, X. & Li, L. Biogenesis and function of extracellular miRNAs. ExRNA1, 38 (2019).
Zhang, S. & Hong, Z. Mobile RNAs—the magical elf traveling between plant and the associated organisms. ExRNA1, 8 (2019).
Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature579, 270–273 (2020).
Commission, C. P. Pharmacopoeia of the People’s Republic of China, Vol. I 221 (People’s Medical Publishing House, 2010).
Wang, M. et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res.30, 269–271 (2020).
Acknowledgements
We thank Wei Ye, Yun Chi, Cong Cheng, Lanlan Ma, Guangchang Dai, and Qian Shi, from the Second Hospital of Nanjing, for their assistance in the clinical study (Chinese Clinical Study Register number, ChiCTR2000029822). In addition, we thank Dr. Zhibin Hu (Nanjing Medical University) for his comments on the paper. This work was supported by grants from the Chinese Science and Technology Major Project of China (2015ZX09102023-003), National Basic Research Program of China (973 Program) (2014CB542300 and 2012CB517603), National Natural Science Foundation of China (81250044, 81602697 and 31742075) and the Natural Science Foundation of Jiangsu Province (BE2016737), the Fundamental Research Funds for the Central Universities (020814380146) and Jiangsu Provincial Medical Youth Talent (QNRC2016056).
Author information
Authors and Affiliations
Contributions
Y.Y., L.-K.Zhang, and C.-Y.Z.conceived and designed the experiments; L.-K.Zhou, Z.Z., X.-M.J., Y.Z., and Z.F. participated in multiple experiments; L.-K.Zhou, Z.Z., G.X., C.Z., L.-K.Zhang, and X.C. analyzed the data. L.-K.Zhou, Z.Z., C.-Y.Z., and L.-K.Zhang wrote the paper. C.-Y.Z., L.-K.Zhang, and Y.Y. provided the final approval of the paper.
Corresponding authors
Ethics declarations
Conflict of interest
The authors declare that they have no conflict of interest.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zhou, LK., Zhou, Z., Jiang, XM. et al. Absorbed plant MIR2911 in honeysuckle decoction inhibits SARS-CoV-2 replication and accelerates the negative conversion of infected patients. Cell Discov 6, 54 (2020). https://doi.org/10.1038/s41421-020-00197-3
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41421-020-00197-3
This article is cited by
-
Investigating the therapeutic effects and mechanisms of Carthamus tinctorius L.-derived nanovesicles in atherosclerosis treatment
Cell Communication and Signaling (2024)
-
miR-92a-1-5p enriched prostate cancer extracellular vesicles regulate osteoclast function via MAPK1 and FoxO1
Journal of Experimental & Clinical Cancer Research (2023)
-
SARS-CoV-2-associated organs failure and inflammation: a focus on the role of cellular and viral microRNAs
Virology Journal (2023)
-
Plant miRNA osa-miR172d-5p suppressed lung fibrosis by targeting Tab1
Scientific Reports (2023)
-
Herbal small RNAs in patients with COVID-19 linked to reduced DEG expression
Science China Life Sciences (2023)