Introduction

Arsenic (As) is one of the most hazardous metalloids1 that has a high chance of reaching the general public via contaminated food and water, agricultural products, irrigated crops, industrial processes, and cigarette use. Chronic exposure above the permissible dose (WHO-10 μg/L) has several harmful consequences on human health, including lung and skin cancers, a variety of neurological, cardiovascular, and excretory problems, pigmentation of the skin and nails, and other fatal conditions2,3.

As induced toxicity primarily depends on its chemical form, with inorganic forms reported to incur more significant toxicological implications2. In nature, the most prevalent inorganic forms are the trivalent (AsIII) and pentavalent (AsV) forms. Due to the higher reactivity with biological material, AsIII causes higher toxicity than AsV4,5.

Globally, over 100 countries have been reported with arsenic contamination in groundwater above the WHO permissible limit (0.01 ppm), with Asia and Europe being the worst affected6. The heavy exploitation of hard rock and alluvial aquifers to compensate for the lack of clean surface water brings elevated levels of As to the surface6. The surplus addition to the natural arsenic contamination occurs due to industrial and agricultural additive waste release6. Thus, there is an emergent need to reduce or remove high levels of arsenic from the potential exposure sources to prevent or reduce the harmful impact of As exposure. Various physicochemical and biological techniques, like oxidation, coagulation, ion exchange, membrane techniques, and adsorption, are available to reduce or remove As contamination7,8,9.

The chemical and membrane-based techniques are usually expensive, produce secondary waste, and thus are not considered eco-friendly. The main benefit of biological treatment over physicochemical treatment is that this does not burden the environment with secondary chemical pollutants. Therefore, natural materials are often preferred to develop eco-friendly and cost-effective bioremediation methods to deal with environmental contaminants like heavy metals. Bioremediation is an economical and sustainable approach, free from other limitations, being practiced widely under several As-contaminated environments10,11. The well-known bioremediation strategies to combat metal pollution include bioaccumulation, oxidation, reduction, precipitation, coagulation, and biosorption12,13,14,15,16,17.

Biosorption is the best technique for developing arsenic remediation, involving the biological surface properties and chemical or physical interaction with the pollutant. The natural material that can adsorb the metal pollutant is called the sorbent or biosorbent, and the contaminant is called the sorbate or biosorbate. This technique provides the best alternative for removing toxic metals from polluted streams by live or dead natural materials14,18.

Numerous reports on arsenic removal using biological materials like plants or microbes like bacteria, fungi, algae, and yeast in living or dead states are available in the literature14,19,20,21,22,23,24,25. The diversified bacterial population from contaminated or uncontaminated sources have profound potential for the development of biosorbent with high adaptability and tolerance, ease of culturing and diverse surface properties make them a valuable bi- resource23,26,27. As biosorption does not involve bacterial metabolism, the inactive or dead biomass is preferred choice of workers to avoid the use of growth media and stringent growth conditions28,29.

Such biomass can also be easily immobilized on suitable substrate to enhance the efficiency and applicability of biosorption process with easy handling, separation and reusability30,31. The potential for regenerating adsorbents and the user-friendly applicability at household and rural levels make adsorption with immobilization an attractive choice. Various immobilizing agents or biomass carrier are known like silica gel, zeonite, diatomaceous earth and synthetic or natural polymer matrixes like polyacrylamide, polyvinyl alcohol, cellulose, agar, carageenan, chitosan, alginate etc30. The simple gelation and great biocompatibility, enhanced mechanical strength and resistance to environmental stress of alginate with CaCl2 crosslinking is preferable bacterial biomass immobilizing agent with evidences to improve biosorption31,32,33. The application-based study to standardize the biosorption potential of any such system requires the efficacy analysis in various environmental variables34,35. The nature of such biosorption can be estimated by biosorption isotherms, kinetics, and thermodynamics, obtained after the computation of experimental results of concentration, time, and temperature variables, respectively36,37,38.

The quest to explore and standardize newer bacteria based biosorbent with the efficiency of biosorption at high arsenic contamination levels with wider applicability has led to the development of the framework of the present study. The specific aim of the study was development and optimization of AsIII biosorbent using AsIII tolerant bacteria.

Thus, the AsIII tolerant bacteria Sp2b was isolated from an arsenic-contaminated site in Punjab, India. This bacteria was characterized for minimum inhibitory concentration (MIC) for AsIII, surface functional properties by Fourier transform infrared spectroscopy (FTIR), and surface morphological study by scanning electron microscopy (SEM).The identification of the bacterium was done as Acinetobacter sp. Sp2b by sequencing and aligning the 16S rDNA sequence with the National Centre for Biotechnology Information (NCBI) database, and analysis of biochemical properties. Prior studies on Acinetobacter provide information about its tolerance to metals and antibiotics and its essential role in metal removal39,40,41,42. Although, various biosorbent for removal of AsIII have been reported in literature43. But the modeling studies for AsIII removal using immobilized Acinetobacter sp.Sp2b is not known.

The dead biomass of Sp2b was selected for optimization and modeling on the basis of efficacy and applicability in initial screening using live and dead biomass with and without immobilization.The biosorption experiments were conducted with condition variables of pH, temperature, initial AsIII dose and biomass to determine the optimum conditions and isotherm, kinetics and thermodynamics modeling. We have also suggested the possible mechanism of biosorption based on the surface binding analysis using SEM–EDX and mapping.

Materials and methods

Selection of the study area

Soil samples were collected from the industrial area of Ludhiana district (30.5312.60″ N, 75° 54′ 17.57″ E) Punjab, a state of India, for isolation and characterization of arsenic-tolerant bacteria.

Isolation of Arsenic tolerant bacteria

The soil was serially diluted and plated on nutrient agar(procured from HiMedia Laboratories Private Limited, India) plates containing 1 g/L of AsIII (sodium-meta-arsenite, NaAsO2, procured from HiMedia Laboratories Private Limited, India). The arsenic tolerant bacterial strain was obtained as pure colonies on separate nutrient agar (NA) plates by repeated quadrant streaking.

Determination of minimum inhibitory concentration (MIC)

The tolerance to AsIII was estimated by exposing the bacterial isolate to variable doses of Sodium-meta-arsenite(1–8 g/L) with calculated AsIII concentration in the range of 13.35–61.61 mM)in nutrient broth(pH-7.4 ± 0.3) at 35 °C with shaking at 120 rpm (Orbital Shaking Incubator, REMI). The growth at each dose was determined as optical density (600 nm) at 24 h, 48 h, and 72 h incubation period using a UV–visible spectrophotometer (Make-Systronics; Type-106). The lowest dose of arsenic, which showed complete growth inhibition, was considered the MIC44,45,46.

Identification and characterization of strain Sp2b

The genomic DNA was extracted from pure Sp2b culture, and 16S ribosomal DNA sequence was amplified using 16S rDNA universal primers. The sequencing of the PCR product was done at Dextrose Technologies Private Limited, Bangalore, India.

Genomic DNA extraction

The fresh culture of Sp2b was homogenized with extraction buffer (1 mL) and mixed with an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) followed by centrifugal separation of upper aqueous phase (14,000 rpm, 15 min). To the upper aqueous phase, an equal volume of chloroform: isoamyl alcohol (24:1) was added and mixed. This tube was centrifuged (14,000 rpm) at room temperature (10 min). The DNA present in the upper aqueous phase was precipitated by adding 0.1 volume of 3 M sodium acetate (pH 7.0) and 0.7 volume of isopropanol and incubated at room temperature (15 min) followed by centrifugal separation of DNA pellet (14,000 rpm for 15 min at 4 °C). The obtained DNA pellet was washed with 70% ethanol (twice), followed by a very brief washing with 100% ethanol and air drying. The washed DNA pellet was then dissolved in TE buffer (Tris–Cl 10 mM pH 8.0, EDTA 1 mM). To avoid any impurity of RNA, 5 µl of DNase-free RNase A (10 mg/mL) was added to the DNA to remove RNA.

PCR amplification of 16S gene

The obtained DNA was used for PCR amplification with 10pM of each 16S forward (F243; GGATGAGCCCGCGGCCTA) and 16S reverse (R1378; CGGTGTGTACAAGGCCCGGGAACG) universal primers using Uni-directional high–fidelity PCR polymerase47,48. The PCR reaction was performed using the Taq Master Mix. Each PCR amplification well contained 1 μL of DNA, 2 μL each of 16s Forward and 16s Reverse Primer, 4 μL of dNTPs (2.5mMeach), 10 μL of 10X Taq DNA polymerase Assay Buffer, 1 μL of Taq DNA polymerase enzyme (3U/mL) and 30 μL of water to make the 50 μL total volume of reaction mixture. The PCR was run with an initial denaturation at 94 °C for 3 min and further run for 30 cycles with denaturation at 94 °C for 1min, annealing at 50 °C for 1min, extension at 72 °C for 2 min, and elongation at 72 °C for 7min.

16SrDNA sequencing

The PCR product of size ~ 1.5 kb was isolated and sequenced uni-directionally using ABI 3130 Genetic Analyzer (sequencing machine), big dye terminator version 3.1 (cycle sequencing kit), BDTv3-KB-Denovo_v 5.2 (Analysis protocol), using Seq Scape v 5.2 (data analysis software).The sequencing mixture was composed of 4μL of big dye terminator ready reaction Mix, 1 μL of DNA Template (100 ng/mL), 2μL of Primer (10 pmol/λ), and 3μL of Milli Q Water to make 10 μL sequencing reaction. The PCR conditions included 25 cycles with an initial denaturation at 96 °C for 5 min followed by 25 cycles of denaturation (96 °C for 30 s), hybridization (50 °C for 30 s), and elongation (60 °C for 1.30 min).

Sequence alignment and phylogenetic tree

The16S rDNA genes sequence data of the bacterial isolate was aligned and analyzed to identify the bacteria and its closest neighbors through BLASTn (nucleotide BLAST, database 16S rRNA sequences) of National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast). Based on the maximum identity score, the first 10 sequences were selected, and the phylogenetic tree was constructed based on the neighbor-joining (NJ) tree method. The tree was generated using the MEGA 11 software package to evaluate the tree topology and calculate the statistical significance of branch points; bootstrapping was performed for the tree with 1000 replicates. The 16S rDNA sequence was deposited in the GenBank to generate the accession number.

Characterization of strain Sp2b

Colony morphology, Staining, and Biochemical tests:-To support the results of bacterial identification by 16S rDNA sequencing, specific characteristics of Sp2b were studied as per Bergey’s Manual of Determinative Bacteriology (1994)49.

SEM (scanning electron microscopy)

The surface morphology of strain Sp2b was studied using SEM. For SEM analysis, the lyophilized bacterial cells were placed on a carbon tape, coated with gold, and inserted in a Field Emission Scanning Electron Microscopy (FESEM-JEOL India Pvt. Ltd, Model number-JSM7610FPLUS) chamber and examined at Manipal University, Jaipur, Rajasthan, India.

FTIR (fourier transform infrared)

The FTIR spectra of surface functional groups of the bacterial isolate were analyzed in the following conditions: Kbr method50, infrared spectral range of 400–4000 cm–1, and resolution of 4 cm–1.

Biosorption studies

The biosorption studies using the bacterial isolate were conducted in two parts. In the first part, we estimated the biosorption capacity of Sp2b biomass in live and dead states before and after immobilization at variable time intervals. This initial study was designed to evaluate the effectiveness and applicability of Sp2b biomass after immobilization for arsenic removal. In the next part, the biosorption potential of calcium alginate immobilized dead bacterial biomass beads (CASp2b) was analyzed under condition variables of pH, temperature, initial AsIII concentration, and biomass dose. We have further computed the experimental results for Langmuir and Freundlich isotherms, pseudo-1st-order and pseudo-2nd-order kinetics, and thermodynamics modeling. The surface morphology and elemental composition of the AsIII exposed and unexposed calcium alginate immobilized dead bacterial biomass beads were also analyzed using SEM, SEM–EDX, and mapping.

The biosorption potential of the sorbents was expressed in terms of removal percentage and biosorption capacity as per Eqs. (1) and (2)51,52,53,54.

$$\mathrm{As\,\, \% \,\, removal }=\frac{Ci-Cf}{Ci}\times 100,$$
(1)

where ci and cf refer to the initial and final concentration of AsIII (AAS estimation).

Equation (2) computes the quantity of arsenic sorbed by the immobilized biomass beads at equilibrium.

$$\mathrm{Arsenic \,\,biosorption \,\,capacity }\left({\text{qe}}\right)=\frac{\left(Ci-Ce\right)V}{M},$$
(2)

where ci and ce refer to the initial concentration and concentration of arsenic (mg) at equilibrium, as per the AAS estimation, V = volume of arsenic-containing deionized water (L), M = wet weight of biomass beads (g).

Bacterial biomass preparation and immobilization

The bacterial isolate was cultured under optimum growth conditions for 48 h, and biomass was separated into live and dead states. The dead biomass was obtained by autoclaving at 121 °C for 15 min at 15lbs pressure. The biomass separation and preparation were done by thrice sequential centrifugal separation (5000 rpm for 15 min) and washing in sterile deionized water. To prepare the calcium alginate immobilized beads biomass beads, 1% (wt/v) sodium alginate powder and 1% wet weight/volume (wt/v) of bacterial biomass were mixed in DDW (double distilled water) using a glass rod and magnetic stirrer. The spherical beads were prepared by drop extrusion of this viscous solution using a 10 mL syringe with a 1.0 mm needle size with an average speed of 1 drop in 2 s into CaCl2 (2%, w/v) solution under regular stirring. These beads were left in the solution for about 2 h for curing, followed by multiple times washing to remove excess unbound Ca2+ to obtain 2 to 3 mm immobilized calcium alginate Sp2b beads (CASp2b) (Fig. 3a). The only calcium alginate beads were also prepared using a similar method without the biomass. The biomass dose used in all biosorption experiments was 2 g in 100 mL (2%) of AsIII amended deionized water except the biomass variation experiment as per literature study55.

Preliminary biosorption study using live and dead bacterial biomass with or without immobilization

The preliminary biosorption study was conducted using 2% (2 g/100 ml) of all the biomass variables, i.e. Sp2b live and dead biomass, and immobilized live and dead biomass in aqueous solution containing AsIII (200 mg/L)56 at pH 9.35 °C for variable time intervals (5–120 min). The equilibrium time and maximum biosorption capacity (qmax) comparison of each biomass (Fig. 3a) indicated the highest biosorption efficiency of CASp2b. Thus, CASp2b was selected for biosorption condition optimization and isotherm, kinetics, and thermodynamics modeling. The time after which no significant increase in biosorption capacity is observed is considered the equilibrium time57,58.

Biosorption experimentation setup using CASp2b

Effect of variables (AsIII)concentration, pH, temperature, biomass

The biosorption experimentations were conducted using the variability of one component (Initial AsIII concentration, pH, temperature, and biomass) at a time to determine the optimum biosorption conditions. The isotherm modeling was conducted with the initial AsIII concentration variables (100, 200, 500, 1000 and 1500 mg/L) biosorption results. Meanwhile, the biosorption kinetics was determined by time variable (5–120 min) results. The results of temperature variability (20 °C, 35 °C, 50 °C) were used to determine the thermodynamic nature of the biosorption process. The biomass dose variation (1%, 2%, 4%) provided an estimate of suitable biomass dose for biosorption.

The experiment of reusability

The reusability of the CASp2b beads was examined in seven cycles of sorption and desorption. The sorption experiments were conducted at optimum conditions (pH 9, 35 °C, 1000 mg/L of AsIII, 20 min contact time). In contrast, the desorption of bound arsenic on beads was done by immersing the beads in 50 ml of 0.1 M HNO3 for 3 h and shaking them at 100 rpm. After each sorption–desorption cycle, the beads were neutralized in 2% CaCl2 and washed in distilled water several times to remove unbound calcium55.

SEM–EDX and mapping of CASp2b

For the SEM imaging, the lyophilized biomass beads of Sp2b were placed on a carbon tape, coated with gold, and inserted in a Field Emission SEM chamber. Energy dispersive X-ray spectroscopy (EDX) was also applied for the surface elemental composition along with layered mapping of different components of the biosorbent surface before and after As exposure(FESEM-JEOL India Pvt. Ltd, Model number-JSM7610FPLUS, at Manipal University, Jaipur).

Methods of arsenic estimation

The biosorption potential of the biosorbent was studied by quantitative estimation of arsenic in the biosorbent exposed to AsIII amended deionized water after suitable contact time. Arsenic concentration was determined using the modified molybdenum blue method12,59 and atomic absorption spectrophotometry60.

Arsenic doses

The AsIII dosing for the experimental setup was prepared from the appropriate dilution of AsIII stock solution. The AsIII stock solution was prepared using sodium meta-arsenite (NaAsO2) procured from HiMedia Laboratories Private Limited,India. The AsIII doses mentioned in the figures represent the dose of NaAsO2 used in the experiments (Figs. 4, 5 and 6). However, the estimated initial ci and final cf AsIII concentrations, which represent the actual AsIII concentration, have been used for all the calculation purposes.

Modified molybdenum blue method

Estimation of Arsenic concentration was done after oxidation of AsIII to AsV(arsenate) by using hydrogen peroxide (H2O2), which is a strong oxidant61, followed by estimation of total AsV by modified molybdenum blue method. This method estimates the AsV concentration in terms of the blue-colored complex of molybdo-arsenate, which is read using a UV–vis spectrophotometer after determining the absorption peak at 840 nm.The AsIII containing water samples were centrifuged and filtered to remove biomass, and 0.3 mL of the resulting supernatant was mixed with H2O2 (0.2 mL), 50% H2SO4 (0.4 mL), 3% Na3MoO4 (0.4 mL), 2% freshly prepared ascorbic acid (0.2 mL) and then heated at 90 °C in the water bath for 20 min. The samples were then cooled to ambient temperature, and ultrapure water was added to make the total volume of 10 mL in the volumetric flask. A standard absorbance curve with different concentrations of sodium-meta-arsenite was prepared to convert the A840 into arsenic concentrations12,59.

Atomic absorption spectrophotometric method for as estimation

The As estimation was done in soil samples and AsIII containing deionized water before and after the biosorption experimentations (after biomass separation) using furnace Atomic Absorption Spectrophotometer (AAS, model A Analyst 100, Perkin Elmer) with standard methodology60 at Team test house, Jaipur.

Safety and disposal

The treated biomass containing AsIII were collected safely and put in yellow colored non-chlorinated plastic bags which were collected, transported, treated and disposed off as per under Biomedical Waste Management (BMWM) Rules, 2016 within 48 h. All these bags were labelled with tag of time, date, type quantity and symbol of Bio Hazard. The waste is pretreated by autoclaving or chemical disinfectants followed by incineration in two chambered incinerator with retention time of two seconds in secondary combustion chamber with suitable devices for controlling air pollution to follow with updated emission standards under BMWM Rules, 201662.

Statistical analysis

All the experiments were performed in triplicates, and the observations were expressed in terms of mean ± standard error.

Results and discussion

Study area

The soil of the industrial area of Ludhiana district in Punjab,a state of India, was found to contain 7.18 mg arsenic per kg of soil as per the soil AAS analysis in the present study. Many regions in Punjab suffer from heavy metal pollution63,64,65. The arsenic contamination is beyond safe limits in more than 13 districts of Punjab. Most arsenic-contaminated areas fall in the Majha Belt of Punjab, including Gurdaspur and Tarn Taran, Amritsar, near the Ludhiana districts66. As per reports, the Arsenic source in the study area’s soil and groundwater (Punjab)is due to geogenic and anthropogenic sources67. Natural contamination appears in the groundwater, with 99 samples of groundwater from industrial regions of Punjab found contaminated with arsenic and other environmentally sensitive elements (ESEs)68. The anthropogenic activities are responsible for additional metal burdens in the soil and water system due to the indiscriminate disposal of industrial waste, as the area around industries shows elevated contamination levels68,69.

Isolation of AsIII tolerant bacterium

The bacterial strain Sp2b was obtained as pure colony on AsIII containing NA plates. A similar method of isolation of arsenic-tolerant bacteria was adopted earlier, where the isolation source was found to be contaminated with arsenic from soil-receiving textile waste45, soil and water-receiving tannery waste70, and from arsenic-accumulating plant Pteris vittata growing near the lead–Zinc mine region71.

Minimum inhibitory concentration (MIC)

The bacterial isolate exhibited tolerance in response to increasing doses of AsIII from 1 to 8 g/L (13.35–61.61 mM of AsIII) (Fig. 1a). The growth was higher at the dose of 1 g/L compared to control (0 g/L) from 48 to 96 h. At the next dose of 2 g/L, the growth of the bacterium was comparable to control (0 g/L) at 48 h of incubation. But unlikely to the control, there was a rapid decline in optical density in subsequent intervals (72 h and 96 h).The toxic effects of growth inhibition were observed in the subsequent doses (3–8 g/L) with complete growth inhibition at 7 g/L (53.88 mM of AsIII). Thus, the minimum inhibitory concentration (MIC) of AsIII was determined with complete growth inhibition at 7 g/L for bacterial isolate Sp2b.Various ranges of MIC for AsIII in bacteria are available in the literature. In our earlier report, four arsenite hypertolerant bacteria were isolated with MIC ranging between 23.9 and 62.2 mM45. In another study on arsenite and arsenate-tolerant bacteria,42 arsenite-resistant bacteria were isolated with MIC ranging from 5 to 40 mM70. High MIC (45 mM) was reported in the 116 arsenic tolerant bacteria isolated from roots of the arsenic hyper accumulator plant P.vittata71. Bacterial tolerance to arsenic is often associated with the presence of arsB and ACR3 arsenic transporter genes71,72. In these studies, the presence of these genes was confirmed with their PCR amplification using specific degenerate primers. The cited literature71 reported that 70.7% of 41 arsenic-resistant bacteria contained genes related to arsB and ACR3 families. It is also suggested that these genes be transferred horizontally in the bacteria residing in arsenic-contaminated regions.

Figure 1
figure 1

Identification of bacterium Sp2b (a) MIC with increasing doses of AsIII (NaAsO2; 1–8 g/L) in Nutrient broth at 35 °C at 120 rpm with determination of MIC at 7 g/L; (b) Agarose gel electrophoresis image -First Lane (1) is of 16 S rDNA PCR product and the second lane (L) consists of DNA 100 bp ladder (100 bp-1500 bp)(original gel image is presented in Supplementary Fig. 1); (c) Phylogenetic tree was constructed based on neighbor-joining (NJ) tree method using MEGA 11 software; (d) SEM image at 15000X.

Full size image

Identification and characterization of strain Sp2b

The genomic DNA extracted from the pure culture of Sp2b was checked qualitatively by agarose gel electrophoresis. The extracted DNA was used for 16S rDNA amplification, which yielded a single amplicon of approximately 1.5 Kb (Fig. 1b; Supplementary Fig. 1). The sequencing of the PCR product and alignment with 16S rDNA sequences in the NCBI database provided a similarity table from the top ten matches (Supplementary Table 1).

Based on the maximum identity score, the first 10 sequences were selected (Supplementary Table 1) and the phylogenetic tree was constructed based on the neighbor-joining (NJ) tree method. The closest matches with the 16S rDNA sequence of the bacterial isolate Sp2b were Acinetobacter calcoaceticus strain BL5 16S with accession number JQ923443 and (99.65% similarity), Acinetobacter sp. strain WWTP-I-0520-A-V-5a with accession number MZ197948 (99.54% similarity). Based on these results, the bacterial isolate Sp2b was taxonomically designated as Acinetobacter sp. strain Sp2b with OP010048 accession number obtained from GenBank. The phylogenetic tree (Fig. 1c) shows the systematic position of the isolate.

The bacteria of the genus Acinetobacter have received significant attention from the scientific community with its presence and tolerance to unfavorable conditions (heavy metal and antibiotic stress). Acinetobacter calcoaceticus (strain STP 14) has been reported to tolerate heavy metal stress like mercury, cobalt, copper, nickel, lead, and cadmium, along with co-resistance to tested antibiotics. This tolerance can be attributed to the differential expression of genes responsible for such resistance, evidenced by the difference in the protein bands of metal-exposed and unexposed bacteria42. These resistance genes can be genomic or plasmid-borne. The sequencing of plasmidome from an arsenic-tolerant Acinetobacter lwoffii (strainZS207) revealed the presence of 9 plasmids, out of which one megaplasmid (size-186.6 kb) was found to contain the heavy metal as well as arsenic resistance genes (ars genes)73.

In another study, arsenic tolerance has been reported in five species of Acinetobacter (A. soli, A.venetianus, A.junii, A. baumannii, and A.calcoaceticus). The arsB and aoxB genes were detected in the genomic and plasmid DNA by PCR amplification using specific primers. These isolates also accumulated arsenic as a function of time and concentration39. Acinetobacter sp. XS21 can oxidize arsenite and remove 70% of arsenic from the soluble-exchangeable fraction compared to the control41. Acinetobacter sp. FM4 is also a good biosorbent for other heavy metals(CrVI, CuII, and NiII)40.

Colony morphology, staining, and biochemical tests

The bacterial isolate Sp2b formed cream-colored circular translucent colonies with lobate margins and no motility when grown at 37 °C for 48 h. The bacterium Sp2b was found to be acid-fast-negative and gram-negative cocco-bacilli. The bacterium was found negative for starch utilization, dextrose fermentation, arabinose fermentation, lactose fermentation, xylose fermentation, nitrate reduction, oxidase, and reductase activity. It was found positive for citrate utilization and indole production. These reports are in agreement with earlier studies on Acinetobacter74,75.

Scanning electron microscopy (SEM)

The outer morphology of strain Sp2b was studied using SEM images (Fig. 1d) as a large cocco-bacilli structure. Immobilization of Sp2b bacterial isolate biomass (Fig. 2a) was done to enhance the interaction between the sorbent and sorbate, which can significantly improve overall AsIII biosorption. Before exposure to AsIII, SEM images of CASp2b appeared as interspaced rough, heterogeneous, mesh-type structure, which helps to increase surface area and provides more sites for adsorption, which favors heterogeneous surface adsorption (Fig. 2b). In a study on the selective removal of copper from a multi-metal mixture using calcium alginate beads, the SEM images showed a similar mesh-type structure to provide more sites for biosorption55. Other reports also observed a similar heterogeneous surface of calcium alginate beads76. After the exposure of CASp2b beads to AsIII, the surface morphology seems to differ with the presence of shiny, clearly visible crystalline patches in SEM images (Fig. 2c). In another study, the surface SEM images of calcium alginate beads prepared with crude extract of arsenate reductase enzyme entrapped in glutaraldehyde were highly porous. Still, after the exposure to arsenate, the surface profile was smooth and unwrinkled. These beads showed optimum AsV biosorptive potential77.

Figure 2
figure 2

(a) Calcium alginate(CA) beads with biomass of Sp2b; (b) SEM images of CASp2b bacterial beads at 5000X; (c) SEM image AsIII exposed CASp2b beads at 5000X; (d) FTIR analysis of Sp2b biomass before and after AsIII treatment with characteristic wavelength peaks.

Full size image

FTIR (fourier transform infrared)

FTIR analysis provided the information about the diverse surface functional groups of AsIII treated and untreated Sp2b biomass in form of spectral peaks. The spectral analysis was done in the range of 400–4000 cm−1 with a resolution of 4 cm−1, following the methodology reported by Refs.78,79. The spectral ranges indicating specific functional groups on the surface of untreated biomass (Fig. 2d) included 2850–3300 cm–1 for Methyl group (C–H),1680–1750 cm–1 for carbonyl group(C=O), 1000–1300 cm–1 for C–O* (functional group), 3239–3550 cm–1 for alcohol (O–H) and broad distribution of 2500–3300 for acids (O–H). The FTIR results indicated the presence of methyl, carbonyl, carboxylic, and alcoholic functional groups on Sp2b surface which could potentially contribute to the binding of heavy metals80.

The FTIR results of the AsIII treated biomass (Fig. 2d) revealed a noteworthy shift in the spectral band positions which indicates the active involvement and chemical modification of the surface functional groups during the AsIII biosorption. The primary significant shift observed in the peaks at 3416 cm–1 corresponds to the O–H stretching band of alcohols or phenols. Additionally, peaks at 2938 cm–1 and 2139 cm–1 are attributed to C–H and C=C bonding of alkane, respectively. The peak at 1545 cm–1 signifies the N=O stretching band of a Nitro compound, while the peak at 1450 cm–1 represents the C=H stretching of alkane. The peak at 1055 cm–1 corresponds to the C–O group banding of aliphatic ether, and the functional group peak at 699 cm–1 is responsible for the C=C bonding of alkane. These identified AsIII biosorption peaks and patterns are consistent with previous studies and highlight the involvement of various aliphatic, aromatic, and nitro compounds with hydroxyl amino groups in AsIII biosorption38.

Furthermore, the sharpening of the band around 3200–3400 cm−1 confirms the predominant involvement of –OH groups in AsIII biosorption81. According to Ref.82 carboxyl groups, are the main functional groups that undergo modification, creating favorable sorption sites for anionic species like AsIII. These negatively charged functional groups are crucial in forming crosslinking bonds with calcium alginate beads and arsenic. The presence of characteristic peaks in the FTIR spectra indicates the successful biosorption of AsIII by CASp2b beads. The chemical adsorption between the functional groups of CASp2b and AsIII is evident from the FTIR peak results, as discussed by Ref.83.

Biosorption studies

Preliminary biosorption study using live and dead bacterial biomass with and without immobilization with contact time variability

The results of this preliminary study indicated higher biosorptive potential of immobilized beads with comparably better biosorption in dead biomass immobilized beads (Fig. 3a). The comparison was made for biosorption capacity and equilibrium time attainment between all types of biomass. The equilibrium time for live and dead biomass was about 60 min and calcium alginate immobilized biomass was 20 min. Effective metal sorbents typically exhibit a characteristic pattern of initial rapid metal removal, followed by a gradual decline until equilibrium is reached, signifying no further increase in biosorption67. A parallel trend in metal biosorption has been observed with sorbents derived from activated teff straw68. In the case of algae biomass Ulothrix cylindricum58, reported an equilibrium time of 60 min. In contrast81 and 82 found that immobilized beads achieved equilibrium in AsIII biosorption within 30 min. This initial rapid increase in biosorption capacity is attributed to the abundance of available adsorption sites. However, beyond a certain point, there is a saturation of sorption sites, leading to the attainment of equilibrium.

Figure 3
figure 3

(a)Biosorption studies-Effect of time variation on biosorption capacity of un-immobilized and Calcium alginate immobilized Sp2b biomass in the dead and live state (at pH-9; AsIII con.-200 mg/L; 35 °C;biomass-2% wt/v; 120 rpm) (b) Pseudo-2nd -order kinetics graph of CASp2b beads.

Full size image

Metal absorption by non-living cells is viewed as a passive process. The utilization of dead biomass in passive biosorption leads to rapid uptake, achieving adsorption equilibrium within 30–40 min, as indicated by literature sources84,85. The mechanism of metal removal in live or dead biomass is different. In live state the active uptake of metal and further enzymatic modification or accumulation is involved86. In dead state the bacterial metabolism is abolished and the biosorption merely occurs due to the interaction of toxicant with bacterial surface functional groups28,29. Moreover, the inactivation by autoclaving is also found to improve the biosorption efficiency, this might be attributed due to the breakdown of bacterial surface structure to expose more functional groups for metal biosorption87. The wider use and applicability of dead biomass have been known to increase by immobilization on suitable substrate with advantage of ease of handling and separation ,larger surface area and improvement on biosorptive potential by many workers30,31,33. Due to the highest biosorption capacity observed with CASp2b (dead biomass immobilized beads) it was chosen for subsequent biosorption experiments.

Biosorption kinetics

The data of contact time variation were plotted using the pseudo-1st-order and pseudo-2nd-order models for the kinetics study. These models assume that the biosorption rate shall be proportional to the number of free active surface binding sites on the biosorbent in the proper power (1st or 2nd) for pseudo-1st -order or pseudo 2nd–order29.

Pseudo-1st-order kinetics

The equation proposed by Lagergren assumes that the change in absorption rate is proportional to the variation between the amount adsorbed and saturation concentration. The experimental data were plotted in the linear version of pseudo-1st-order kinetics with ln(ci/ct) on the Y axis and time (t) to determine the rate constant (K1) and R2 by the slope of experimental data using the Eq. (3)88 (Supplementary Fig. 2).

$$\frac{dqt}{dt}={K}_{1}\left({q}_{e}-{q}_{t}\right).$$
(3)

Pseudo -2nd-order kinetics-The Pseudo 2nd -order linear equation56,88 is written as,

$$\frac{t}{qt}=\frac{1}{K2{qe}^{2}}+\frac{t}{qe},$$
(4)

where qe and qt represent equilibrium sorption capacity and sorption capacity (mg/g), at the time (t), K1 and K2 are the rate constant of the Pseudo -2nd -order kinetics sorption kinetics (min–1), the linear graph is drawn with t/qt and contact time (t) (min).

The biosorption of AsIII on CASp2b supports the pseudo-2nd–order kinetics with the R2 value of 0.968 (Fig. 3b).The pseudo-2nd-order kinetics supports chemisorption as the mode of biosorption89. The pseudo 2nd-order kinetics have also been found suitable for the adsorption of copper, zinc, and cobalt on calcium alginate beads with R2 value of 0.99976. Therefore, it is suggested that this biosorption process might have occurred by chemical interaction between AsIII in the solution and two surface active or binding sites on the biosorbent29.

Biosorption studies using CASp2b

Effect of initial AsIII concentration and Isotherm studies

The biosorption potential of CASp2b using variable initial AsIII doses under optimal conditions is depicted in (Fig. 4a).The biosorption capacity of CASp2b increased with AsIII dose from 100 to 1500 mg/L from 1.97 ± 0.07 to 20.1 ± 0.76 mg/g. The AsIII removal percent from 100 to 1000 mg/L dose was 44.84 ± 1.56% to 53.53 ± 1.87%, followed by a decline to 36.12 ± 0.16 at the higher 1500 mg/L dose. A similar pattern of variability of biosorption concerning initial concentration has been reported in earlier studies21,79. Similarly, low biosorption % of AsIII and AsV on bacterial biosorbent (B. salmalaya biomass) at a low dose (500 μg/L) and high at a higher dose (1000 μg/L) has been reported earlier56. This phenomenon occurs because of a reduction in the metal's resistance capacity in an aqueous solution with an increase in AsIII concentration 90,91. At higher doses, the gradual decline in the availability of surface binding sites on the biosorbent might be responsible for reduction in biosorption89,90,91.

Figure 4
figure 4

Biosorption studies of CASp2b (a) at variable initial concentration of AsIII (b) Freundlich Isotherm (c) at variable pH (d) using variable biomass. The constant conditions of biosorption experimentations include (temp-35 °C; 120 rpm, time-20 min, pH-9).

Full size image

The equilibrium isotherms are used to describe the experimental adsorption data. These isotherms help predict the nature of biosorption by mutual sorbate and sorbent interaction. In this study, we have plotted the experimental data onto Langmuir and Freundlich isotherm models with their determination coefficient (R2). Regression value is essential in defining the suitability of kinetics and isotherms models for our experiments. The value of R2 is regarded as a measure of the goodness of fit of the experimental data to the isotherm models. The R2 value of a favorable linear isotherm graph can be in the range of 0–1, with a perfectly linear graph at 1; therefore, the best-fit isotherms are considered with values either one or close to one.

The Langmuir isotherm model mechanism assumed by the Langmuir isotherm is the sorption of the sorbate as a uniform or homogenous single layer. Once the sites are saturated, no further increase in sorption shall occur92. The Langmuir isotherm can be expressed in its linear form by the given Eq. (5)

$$\frac{{C}_{e}}{{q}_{e}}=\frac{1}{{q}_{max}K}+\frac{{C}_{e}}{{q}_{max}},$$
(5)

where (Ce) is the equilibrium concentration,(K )is the equilibrium constant, and qmax is the maximum absorption capacity. The Langmuir isotherm regression value (R2) obtained was 0.223 from the linear graph plotted between (Ce/qe) versus Ce (Supplementary Fig. 3).

Freundlich isotherm model: The Freundlich equation and graph (Fig. 4b) describe the heterogeneous nature of the adsorption process93. The Freundlich adsorption isotherm can be expressed in the linearized form94 by the following Eq. (6),

$${\text{log}}{q}_{e}={\text{log}}{k}_{f}+\frac{1}{n}{\text{log}}{C}_{e},$$
(6)

where Ce is the equilibrium concentration, (kf ) and (n)are constant, which can evaluated from slopes and intercepts. The graph plotted between log qe versus log Ce in a linear equation.

The data of the concentration variability experiments under optimum conditions was computed in the respective isotherm equations to predict the most appropriate closely fitted equilibrium adsorption isotherm. After the computation of biosorption results, the R2 value was obtained, as shown in Table 1.The Freundlich isotherm was the best fit for CASp2b with R2 value of 0.941.The Freundlich isotherm is used for multilayer adsorption on heterogeneous sites with a two-parameter model1,95. Freundlich model is also suitable for other adsorption studies with different adsorbents and adsorbates1.

Table 1 Biosorption isotherm results of CASp2b.
Full size table
Effect of pH

Biosorption mainly depends on the sorbate’s chemical nature and the sorbent's surface functional groups, which rely on the pH of the solution82,96. Thus, pH is considered the most critical factor for estimating sorption capacity using any sorbent. The effect of pH variation on the biosorption efficiency of AsIII on CASp2b was studied at variable pH 5, 7, 9, 11 (Fig. 4c), keeping the other factors constant (Biomass dose: 2 gm wet weight in 100 mL, contact time: 20 min, temperature: 35 ℃, NaAsO2 concentration: 1000 mg/L). The results of pH variation experiments showed increased biosorption capacity and AsIII removal percent with increasing pH, with their peaks at pH 9 (18.99 ± 0.75 and 54.81 ± 1.91) followed by a decline at pH 11 (15.08 ± 0.57 and 43.53 ± 1.52).

The alkaline pH is also suitable (maximum at pH8) for the sorption of AsIII on octahedral TiO2 nanocrystals97. The cation exchanger biosorbent developed by saponification of waste watermelon rind to the increase carboxyl functional groups also exhibited an increase in biosorption with an increase in pH upto pH 1282. The pH of the solution directly affects the chemical state of arsenic. AsIII primarily exists as a neutral species (H3AsO3) in the acidic to a neutral range(pH 2–7) but exists as an anionic species (H2AsO3–1) and (HAsO3–2) in the alkaline pH range of 7–1282. These anionic species (H2AsO3–1 and HAs O3–2) of As at pH 9 might be responsible for better interaction with the biosorbent used in the present study.

Effect of biomass variation

The effect of biomass on biosorption capacity was studied using three different biomass percent(1%, 2%, and 4% wet biomass) with a constant AsIII dose (200 mg/L),which is shown in (Fig. 4d).The highest arsenic removal percent and biosorption capacity was observed with 4% biomass (54.64 ± 2.26% and 4.81 ± 0.19) followed by 2% (50.92 ± 1.27% and 4.48 ± 0.17) and 1% (36.03 ± 1.27%, 3.17 ± 0.11), showing an increase in biosorption with the increase in biomass (CASp2b).This increase can be attributed to the rise in surface area available for sorption56. The minor difference in biosorption capacity (mg/g of biomass) with increasing biomass concentration might be due to the splitting of the concentration gradient98.

Effect of temperature variation and thermodynamics

Temperature is considered an essential factor that affects the biosorption process tremendously. The effect of variable temperatures on the arsenic biosorption by CASp2b was examined under optimum experimental conditions with three temperature variations (20 ℃, 35 ℃, 50 ℃)and keeping the other factors constant(Biomass dose: 2 gm wet weight in 100 mL, contact time: 20 min, NaAsO2 concentration: 1000 mg/L). In our investigation, we noted a temperature-dependent rise in the removal percentage and biosorption capacity of AsIII, as outlined below: at 20 ℃ (R% = 21.33 ± 0.74, qe = 7.39 ± 0.03 mg/g), 35 ℃ (R% = 53.09 ± 2.12, qe = 18.4 ± 0.13 mg/g), and 50 ℃ (R% = 59.55 ± 2.08, qe = 20.64 ± 0.14 mg/g) for the biomass, respectively (Fig. 5a).

Figure 5
figure 5

Biosorption studies for AsIII using CASp2b (a) at variable Temperatures (20 °C, 35 °C, 50 °C); (b) Van’t Hoff plot of thermodynamics (c) Reusability of CA Sp2b beads in terms of AsIII removal % and biosorption capacity in seven cycles (AsIII − 1000 mg/L;pH 9; Biomass dose-2% wt/v; 20 min;35 °C; pH9; 120 rpm).

Full size image

The observations are consistent with earlier studies99,100 with temperature dependent rise of biosorption due to rise in kinetic energy, decrease in liquid viscosity and increase in surface activity. Moreover, elevation of temperature promotes the rate of diffusion of metals or sorbent from outer to the inner layers through the porous surface due to decrease in liquid viscosity.

The results of temperature variation were used to estimate biosorption thermodynamics. The evaluation of the thermodynamics of the biosorption process is essential to find the applicability of arsenic removal in natural systems, as this is a temperature-dependent process101. Thermodynamics parameters like ΔG° (Gibb's free energy), ΔH° (enthalpy), and ΔS° (entropy) are indicators of the possible nature of metal adsorption by green adsorbents. The reaction is considered spontaneous with a negative value of ∆G° and non-spontaneous with a positive value of ∆G°102. In a study, adsorption of AsIII ions by green adsorbent was spontaneous with negative ∆G˚ values at the studied temperatures103. The following equation was used to estimate the thermodynamics of the biosorption process54,104,105.

$$\Delta G=-RT{\text{ln}}{K}_{c},$$
(7)
$${K}_{c}=\frac{\Delta H^\circ }{RT}-\frac{\Delta S^\circ }{RT},$$
(8)
$$\Delta G^\circ =\Delta H^\circ -T^\circ\Delta S^\circ ,$$
(9)

where ΔG° is Gibb’s free energy, ΔH° is enthalpy, ΔS° is entropy, R = gas constant (8.314 J/mol K) and T is the temperature (K), Kc is the distribution constant. The values of ΔH° and ΔS° (Table 2) were determined from the slope and intercept of the graph plotted between ln Kc (Y-axis) versus 1/T (X-axis) (Fig. 5b).

Table 2 Biosorption thermodynamics results of CASp2b.
Full size table

In our study (Table 2), the values of ΔG°were negative at the studied temperatures (− 16.99, − 17.99, − 18.74 at 293 k, 308 k, 323 k respectively).The negative ΔG° values increased with temperature, suggesting the biosorption is spontaneous106. The positive ΔH° value shows the endothermic nature of the biosorption of AsIII on CASp2b. The positive ΔS° value indicates increased randomness at the interface of the biosorbent and the AsIII amended aqueous solution. This increased randomness can be due to ligand exchange reaction at the interface during biosorption82. The thermodynamics parameters show that the process favors the removal of arsenic ions by CASp2b. The arsenic removal process by using the modified biomass of watermelon rind was also found to be spontaneous with negative ΔG° values and positive ΔH° and ΔS° values82.

Experiment of reusability

The reusability of the biosorbent CASp2b was investigated and the outcomes for seven consecutive cycles are depicted in Fig. 5c. The analysis of biosorption capacity shows reasonable reusability of the CASp2b beads from first to the fifth reuse cycle (17.27 ± 0.65–12.84 ± 0.5 mg/g). However, a notable decline occurred in the sixth and seventh cycles to 3.91 ± 0.13 and 3.11 ± 0.11 mg/g. Other workers have reported a similar “biosorption” reusability pattern55,107. This indicated suitability of the regeneration process upto five cycles.

SEM–EDX mapping of CASp2b

SEM was applied to examine the surface morphological characteristics of the biosorbent(CASp2b)and chemical characteristics were analyzed with EDX graphs and mapping before (Fig. 6) and after Arsenic biosorption (Fig. 7).The elemental mapping and EDX spectra provide clear evidence of AsIII biosorption on CASp2b beads, as shown in Table 3.The EDX and mapping analysis shows the presence of elements like Carbon (C), Oxygen (O), Sodium (Na), Phosphorous(P), Chlorine (Cl), Potassium (K), Calcium (Ca), Copper (Cu) and Arsenic (As).The elemental composition (wt % and atomic %) was variable in the Arsenic unexposed and exposed group. The presence of sodium and arsenic on the surface of the arsenic-exposed group indicates surface biosorption of sodium and arsenic derived from sodium-meta-arsenite, which was added in the batch experimentations ).

Figure 6
figure 6

Energy dispersive spectroscopy (EDX) analysis of AsIII unexposed CASp2b beads (a) SEM area under EDX analysis; (b) EDX mapping images of all overlapping elements. (c) EDX spectrum analysis of showing elemental composition and Elemental maps of (d) Oxygen (e) Carbon (f) Sodium (g) Phosphorous (h) Chlorine (i) Potassium (j) Calcium (k) Copper (Original figures are presented as Supplementary Fig. 4).

Full size image
Figure 7
figure 7

Energy dispersive spectroscopy (EDX) analysis of AsIII exposed CASp2b biomass beads (a) SEM area under EDX analysis; (b) EDX mapping images of all overlapping elements. (c) EDX spectrum analysis showing elemental composition and Elemental maps of (d) Carbon (e) Oxygen (f) Sodium (g) Chlorine (h) Potassium (i) Calcium (j) Copper (k) Arsenic (Original figures are presented as Supplementary Fig. 5).

Full size image
Table 3 Elemental composition of arsenic unexposed and exposed CASp2b beads.
Full size table

These results imply that CASp2b consisting of AsIII-tolerant Acinetobacter bacterial species showcased remarkable biosorption with applicability at even elevated AsIII concentrations, achieving over 35% AsIII removal even at a high concentration of 1500 mg/L of AsIII. Notably, at an elevated temperature of 50 °C, the biosorption exceeded 55% AsIII removal. Additionally, it was observed that CASp2b showcased significant potential for reusability.

Comparison of CASp2b with other AsIII biosorbent

The comprehensive findings emphasize the diverse potential of various biomaterials and microbes for biosorption, especially in removing AsIII from waste water. Table 4 presents the maximum adsorption capacity (qmax) and optimal conditions for AsIII across various adsorbents explored in the literature alongside CASp2b81,108,109,110,111. Different biomasses of bacteria, fungi, algae, or plants have been tested in untreated dried or carbonized states for biosorption. Other workers have immobilized the biomass with metals like Fe, Mn, La to increase the AsIII binding efficiency.

Table 4 Comparison of CASp2b with other AsIII biosorbents.
Full size table

Upon comparison, the biosorption capacity of CASp2b with other biosorbents exhibits moderate efficiency, considering wet-weight biomass for estimation in the current study. The calcium alginate immobilization of biomass has been applied for the removal of various metals like Ni, Pb, Zn112 and Cr, PdII 113 with high efficiency of metal removal, but evidence of AsIII removal is rare. Consequently, the AsIII biosorbent CASp2b distinguishes itself through its unique methods of preparation, utilization in wet biomass state, optimal biosorption conditions, and comparable efficiency in AsIII removal, as presented in Table 4.

Biosorption is a complex process involving the chemical nature of the sorbate sorbent and other factors. The sorption behavior of heavy metals on biosorbent mainly depends on the oxidation state of metal and the surface functional groups on the biosorbent and the interplay of physical and chemical interactions between them61,114. Biosorption is impacted by many factors, such as pH, the simultaneous presence of other metals, the kind of biosorbent material, and many more40,82,96,97. The study’s results indicate the AsIII biosorption potential of CASp2b, which can be used as an alternative to reduce arsenic contamination in water.

In the present study, the prime variables that affect the biosorption process, such as temperature, pH, biomass, and initial sorbate concentration, have been studied for the developed sorbent CASp2b. However, the efficacy of this biosorbent in natural conditions with the interference of other salts, metals, etc., needs to be explored in further studies. In earlier investigations40,42, the biosorption capabilities of Acinetobacter species in the presence of multiple metals, including Cd, CrVI, CuII, and NiII. The research findings indicate that beyond the metals mentioned, Acinetobacter exhibits potential as a viable biosorbent for AsIII. Our study aligns with other investigations focused on AsIII biosorption using microbes. Although our Acinetobacter strain demonstrates a lower qmax of 20.1 mg/g compared to other studies, noteworthy characteristics include its effectiveness at high concentrations (1500 mg/l) and elevated temperatures, with substantial reusability. Therefore, Acinetobacter emerges not only as a proficient biosorbent for AsIII removal from contaminated water but also holds promise as a prospective option for removing other heavy metals in the future.

Conclusion

This study compiles the isolation and development of an AsIII biosorbent using the biomass of bacterial isolate Sp2b.This bacterium Sp2b showed hyper-tolerance to AsIII with MIC of 7 g/L (53.88 mM). It was designated as Acinetobacter sp. strain Sp2b per the sequencing, biochemical, and staining results.On comparing the biosorption capacity of the calcium alginate immobilized dead bacterial biomass (CASp2b) to the live immobilized biomass, it was discovered that both demonstrated better biosorption efficiency than the unimmobilized (biomass alone) biomass. The application of the CASp2b in a batch reaction system with the advantage of easy removal, reusability, and enlargement of surface area with higher metal affinity was conducted using variables of pH, initial AsIII concentration, biomass, and temperature to obtain optimum biosorptive conditions. This batch of experimental systems using the CASp2b exhibited encouraging biosorption potential. At the optimum conditions of biosorption with 35 °C, pH 9, using 2gm wet weight in 100 mL with an agitation speed of 120 rpm within 20 min of contact time, using 1000 mg/L of initial AsIII concentration, the removal percentage of AsIII was 53.53%, and a maximum biosorption capacity (qmax) of 20.1 ± 0.76 mg/g was obtained. The isotherm and kinetic modeling of the experimental data favored Freundlich isotherm (R2 = 0.941) and pseudo-2nd-order kinetics (R2 = 0.968).The biosorption analysis data of CASp2b fitted best in the Freundlich isotherm instead of the Langmuir isotherm, indicating the multiplayer sorption and chemisorption as dominant adsorption mechanisms as per the pseudo-2nd-order kinetics.

The thermodynamic study suggested the spontaneous and endothermic nature of this biosorption process with negative ΔG° values at all the temperatures along with positive enthalpy (ΔH ̊ = 27.42) and entropy (ΔS° = 58.1). These results indicate the potential application of CASp2b for the remediation of arsenic-contaminated water with reasonable reusability to reduce the arsenic-generated toxic effects. The research represents a valuable contribution to understanding arsenic biosorption materials by employing immobilized Sp2b biomass beads. These beads have demonstrated the ability to efficiently eliminate elevated concentrations of AsIII from aqueous solutions, particularly at moderate to high temperatures.