LSD1 inhibition circumvents glucocorticoid-induced muscle wasting of male mice

Cai, Qingshuang; Sahu, Rajesh; Ueberschlag-Pitiot, Vanessa; Souali-Crespo, Sirine; Charvet, Céline; Silem, Ilyes; Cottard, Félicie; Ye, Tao; Taleb, Fatima; Metzger, Eric; Schuele, Roland; Billas, Isabelle M. L.; Laverny, Gilles; Metzger, Daniel; Duteil, Delphine

doi:10.1038/s41467-024-47846-9

Download PDF

Article
Open access
Published: 26 April 2024

LSD1 inhibition circumvents glucocorticoid-induced muscle wasting of male mice

Nature Communications volume 15, Article number: 3563 (2024) Cite this article

855 Accesses
14 Altmetric
Metrics details

Subjects

Abstract

Synthetic glucocorticoids (GC), such as dexamethasone, are extensively used to treat chronic inflammation and autoimmune disorders. However, long-term treatments are limited by various side effects, including muscle atrophy. GC activities are mediated by the glucocorticoid receptor (GR), that regulates target gene expression in various tissues in association with cell-specific co-regulators. Here we show that GR and the lysine-specific demethylase 1 (LSD1) interact in myofibers of male mice, and that LSD1 connects GR-bound enhancers with NRF1-associated promoters to stimulate target gene expression. In addition, we unravel that LSD1 demethylase activity is required for triggering starvation- and dexamethasone-induced skeletal muscle proteolysis in collaboration with GR. Importantly, inhibition of LSD1 circumvents muscle wasting induced by pharmacological levels of dexamethasone, without affecting their anti-inflammatory activities. Thus, our findings provide mechanistic insights into the muscle-specific GC activities, and highlight the therapeutic potential of targeting GR co-regulators to limit corticotherapy-induced side effects.

Temporal dynamics of the multi-omic response to endurance exercise training

Article Open access 01 May 2024

Multimodal cell atlas of the ageing human skeletal muscle

Article Open access 22 April 2024

The impact of exercise on gene regulation in association with complex trait genetics

Article Open access 01 May 2024

Introduction

Since the first clinical use in the late 1940s, glucocorticoids (GC) have revolutionized the field of medicine. Indeed, synthetic GC, such as prednisone and dexamethasone (DEX), are prescribed for many chronic inflammatory conditions¹, including colitis, rheumatoid arthritis, multiple sclerosis and asthma, as well as for immunosuppression in organ-transplanted patients². It is estimated that 1−3% of the population of Western countries are long-term users of GC^3,4,5,6. However, systemic treatments are limited by various side effects, including diabetes, osteoporosis and muscle wasting⁷. As to date, none of the many synthetic GC analogues has anti-inflammatory effects that are fully dissociated from iatrogenic effects, new therapeutic strategies are in demand.

GC activities are mediated by the glucocorticoid receptor (GR; NR3C1), a member of the nuclear receptor superfamily. GC induce the translocation of GR into the nucleus, where it binds to its response elements (GREs and nGREs) and recruits various co-factors^8,9,10, or interferes with other transcription factor activity, to regulate target gene expression^11,12. Interestingly, recent studies indicate that various transcriptional co-regulators play a key role in GR cell-specific effects. For instance, GR has been shown to interact with FOXA2 in hepatocytes to promote gluconeogenesis¹³, with FOXA1 in prostate cancer cells to stimulate androgen receptor (AR)-regulated pathways under androgen-deprived conditions¹⁴, with MYOD1 in muscle fibers to negatively regulate muscle mass¹⁵, and with forkhead box O1 (FOXO1) to induce muscle atrophy in C2C12 cells exposed to DEX¹⁶.

Lysine-specific demethylase 1 (LSD1, also called KDM1A) is a flavin adenine dinucleotide (FAD)-dependent amine oxidase involved in transcriptional gene regulation^17,18. Within the repressive CoREST complex, LSD1 demethylates mono- and di-methylated histone H3 at lysine 4 (H3K4me1 and H3K4me2) to inhibit transcription, whereas it promotes gene expression via demethylation of mono- and di-methylated histone H3 at lysine 9 (H3K9me1 and H3K9me2) in collaboration with various transcription factors^19,20. A recent study revealed that LSD1 is part of the GR nuclear complex in the presence of DEX and demethylates H3K4me2 in the lung adenocarcinoma cell line A549²¹. A direct interaction between LSD1 and GR was also reported in HeLa cells²¹, and LSD1 was shown to be essential for muscle fiber regeneration upon injury²². Since LSD1 controls the activity of various transcription factors, mediates GC-dependent metabolic reprogramming during myogenic differentiation²³, and can be targeted with inhibitors^24,25,26, this co-factor is a potential candidate to modulate GR activity in a cell-specific manner.

Here we show that LSD1 interacts with GR at enhancer regions in skeletal muscles at both physiological and pharmacological GC levels, and establishes a functional link with the transcription factor NRF1 at promoter sites to modulate the expression of genes controlling anti-anabolic and catabolic pathways. The interplay between LSD1 and GR in myofibers is also crucial for promoting muscle atrophy during the first hours following nutrient deprivation. Importantly, our findings demonstrate that the selective LSD1 inhibitor CC-90011 attenuates DEX-induced muscular atrophy, without affecting its anti-inflammatory properties. Consequently, targeting GR co-activators such as LSD1 opens therapeutic opportunities to circumvent deleterious consequences associated with GC administration.

Results

LSD1 interacts with GR to control target gene expression in mouse myofibers at physiological GC levels

To unveil whether LSD1 regulates GR activity in skeletal muscles under physiological conditions, we characterized GR and LSD1 expression, and found that both proteins were present at similar levels in muscles composed mainly of slow oxidative fibers (e.g., soleus) or fast-glycolytic fibers (e.g., gastrocnemius, tibialis and quadriceps) (Supplementary Fig. 1a). GR and LSD1 were mainly located in the skeletal muscle nuclei of both slow and fast-twitch myofibers, in which they colocalize (Fig. 1a and Supplementary Fig. 1b) and interact as revealed by co-immunoprecipitation experiments (Fig. 1b). To determine GR and LSD1 genomic localization in limb muscles, we conducted ChIP-seq experiments on 9-week-old mice using anti-LSD1 and anti-GR antibodies. Peak calling analysis revealed a total of 16,616 LSD1-binding sites (LSDBS) distributed across 9057 genes, and 14,108 GR-binding sites (GRBS) located in 7486 genes. LSDBS were evenly distributed across the genome [24% in intergenic, 35% in intronic and 33% in proximal promoter regions (TSS, −1 kb to +100 bp)], a repartition similar to that of GRBS in skeletal muscles (Supplementary Fig. 1c), in agreement with our previous studies¹⁵. Importantly, bedtools analysis revealed that more than half of GR peaks share the same locations with LSD1 peaks. In addition, 5649 genes were bound by both proteins (Supplementary Fig. 1d), and SeqMINER analysis revealed that about 80% of the DNA segments bound by LSD1 correlate with GR occurrence (Fig. 1c, d). Pathway analysis revealed that these common genes belong to insulin and EGFR1 signaling, and nuclear receptor signaling among other networks (Supplementary Fig. 1e). Examples of genomic regions of previously described GC target genes^16,27 bound by both GR and LSD1 (e.g., Ddit4, Trim63 and Fbxo32, also known as Redd1, Murf1 and Atrogin1, respectively) are depicted in Fig. 1e and Supplementary Fig. 1f. In the Ddit4 locus, we identified four binding sites shared by GR and LSD1, three located at 17−27 kb upstream of the TSS, referred to as GBSe1, GBSe2 and GBSe3, and one at the promoter region (GBSp1) (Fig. 1e), and ChIP-qPCR analysis confirmed the presence of LSD1 and GR at these sites (Supplementary Fig. 1g). Whereas GBSe2 (5’-AGAACAttgTGTTCT-3’) corresponds to a consensus GRE¹⁵, GBSe1 (5’-GGAACAgcaTGTGCA-3’) and GBSe3 (5’-AGAACGctcTGTACC-3’) differ from the consensus on the second and the two half-sites, respectively, and no GRE-like sequence could be identified for GBSp1 that mainly encompasses GC-repeats. To demonstrate that LSD1 and GR co-localize on the Ddit4 GBSs, we performed a two-step ChIP (Re-ChIP) experiment in mouse skeletal muscles. This analysis revealed an enrichment at the four GBSs when skeletal muscle nuclear extracts were first immunoprecipitated with an anti-GR antibody and then with an anti-LSD1 antibody, or vice versa (Fig. 1f). Altogether, these results show that GR and LSD1 interact at genomic loci of GC target genes in skeletal muscles.

**Fig. 1: LSD1 interacts with GR to control target gene expression in mouse myofibers at physiological glucocorticoid levels.**

To characterize LSD1 function in skeletal muscles, we generated LSD1^skm-/- mice, by intercrossing mice bearing floxed LSD1 first exon with the myofiber-specific HSA-Cre deleter strain (Supplementary Fig. 1h). Western blot and immunofluorescence analyses revealed that LSD1 was efficiently ablated in myofibers of LSD1^skm-/- mice (Supplementary Fig. 1i, j). Notably, hematoxylin and eosin (H&E) staining showed that the histology of 9-week-old LSD1^skm-/- muscles was similar to that of control mice (Supplementary Fig. 1k). Furthermore, body, muscle and adipose tissue weights, as well as muscle strength, were not significantly affected at 9 weeks by LSD1 loss in myofibers (Supplementary Fig. 1l, m). However, RNA sequencing (RNA-seq) on gastrocnemius muscles from 9-week-old control and LSD1^skm-/- mice identified 2669 differentially expressed genes (reads > 50 and p < 0.05). Bioinformatic analyses combining ChIP-seq and RNA-seq datasets showed that LSD1 is bound to 742 genes that are up-regulated in skeletal muscles of LSD1^skm-/- mice, and 845 that are down-regulated, that are associated with various pathways including “Cushing syndrome” and “Focal adhesion”, and “Mitophagy” and “Autophagy”, respectively (Supplementary Fig. 1n). In addition, the overlap between genes bound by both GR and LSD1 in skeletal muscles, and genes downregulated upon LSD1 ablation, revealed that GR and LSD1 are co-recruited to half of the LSD1 target genes (Supplementary Fig. 1o). Moreover, these results combined with our previously published RNA-seq data of myofiber GR-deficient mice (hereafter GR^(i)skm-/- mice)¹⁵ revealed that half of the genes down-regulated in gastrocnemius of GR^(i)skm-/- mice are bound by both GR and LSD1 (Supplementary Fig. 1p). In addition, the comparison between GR and LSD1 transcriptomes unveiled that 778 genes are down-regulated and 456 are up-regulated in skeletal muscles of both LSD1^skm-/- mice and GR^(i)skm-/- mice (Fig. 1g). Pathway analysis of the genes down-regulated in both mutant mice uncovered FOXO signaling (e.g., Foxo4, Gsk3b, Sirt1, Stat3 and Ubc), autophagy (e.g., Becn1, Bnip3, Ctse and Ulk2), mitophagy (e.g., Cited2, Mfn1, Nbr1 and Usp15) and insulin signaling pathways (e.g., Calm1, Pik3r1, Pik3r3 and Tsc22d1) (Fig. 1h), whereas the genes upregulated in both mutant mice belonged to pathways including focal adhesion (e.g., Chad, Col1a1, Lama4 and Mylk), hepatocyte growth factor signaling (e.g., Hras, Itga1, Pak1 and Rasa1) and PI3K-Akt-mTOR pathway (e.g., Fgf1, Fgf11, Mapk3 and Rps6) (Fig. 1i). Altogether, our data show that GR and LSD1 interact at a large number of loci in myofibers at physiological GC levels to control both anabolic and catabolic pathways.

LSD1 bridges GR at active enhancers and NRF1 at active promoters to control target gene expression

The seqMINER-generated heatmap of LSD1, GR and our previously published histone mark datasets^15,28 showed that about 42% of the LSDBS were located at active promoters (7044 peaks), defined by the presence of H3K4me2 and H3K4me3, and low H3K4me1 levels, and 42% at active enhancers (7026 peaks), characterized by the presence of H3K4me1 and H3K4me2, and low H3K4me3 levels (Fig. 2a). A similar analysis revealed that more than half of GRBS were located at active enhancers, and 31% of them at active promoters (Supplementary Fig. 2a), in accordance with our previously reported datasets¹⁵. Hypergeometric optimization of motif enrichment (HOMER) de novo analysis of LSDBS revealed that LSD1-associated enhancer regions encompass binding sites for the transcription factors MEF2C, SIX2 and GR (Fig. 2b). In agreement with our previous work¹⁵, GR was bound to GREs at enhancers (Supplementary Fig. 2b). In contrast, most of the GR and LSD1 co-occupied promoter regions were GC-rich elements, including the motif for the transcription factor nuclear respiratory factor 1 (NRF1, 5’-GCGCatGCGC-3’) (Fig. 2c and Supplementary Fig. 2c). Co-immunoprecipitation experiments revealed that LSD1 was immunoprecipitated by anti-NRF1 antibodies in mouse skeletal muscle nuclear extracts (Fig. 2d), and immunoprecipitation of purified recombinant LSD1 in the presence of purified recombinant NRF1 protein revealed that the interaction between both proteins is direct (Fig. 2e).

Importantly, whereas NRF1 was immunoprecipitated by GR antibodies in muscle nuclear extracts, in agreement with our previous results¹⁵, NRF1 and GR did not interact in muscles of LSD1^skm-/- mice (Fig. 2f), indicating that LSD1 is required for this interaction. In agreement with these results, ChIP-qPCR experiments revealed that both GR and NRF1 are recruited to GBSe2 of the Ddit4 gene in skeletal muscles of control mice, and that NRF1 recruitment is decreased by more than 70% in LSD1^skm-/- mice, whereas that of GR was not affected (Fig. 2g). Moreover, whereas GR and NRF1 were detected at the Ddit4 GBSp1 in controls, GR binding was impaired in LSD1-depleted myofibers, whereas that of NRF1 was not (Fig. 2g). Of note, as a negative control, we found that GR and NRF1 were not enriched at the promoter region of the Pax7 gene that was not identified as a GR or LSD1 target by ChIP-seq (Fig. 2g and Supplementary Fig. 2d).

To determine if the DNA segments bound GR and LSD1 are bound by NRF1 as well, we conducted a ChIP-seq analysis on skeletal muscle nuclear extracts, identifying 3130 NRF1 binding sites (Supplementary Fig. 2e). HOMER motif analysis confirmed the predominance of the NRF1 motif at NRF1-bound genomic locations (Fig. 2h). Most of the NRF1 peaks were located at promoter regions (−1000 bp to 100 bp from TSS), corresponding to 2955 genes. These genes were mainly associated with pathways involved in ubiquitin-mediated proteolysis and OXPHOS (Supplementary Fig. 2e, f). Our studies revealed that the presence of GR and LSD1 at promoters strongly correlates with that of NRF1, in contrast to GR-LSD1 bound enhancers for which NRF1 binding was not detected, as exemplified for various catabolic genes (Fig. 2i, j and Supplementary Fig. 2g). These findings were further supported by ChIP-qPCR experiments conducted at multiple loci (Fig. 2g and Supplementary Fig. 2h). Analysis of the overlaps between GR, LSD1 and NRF1 target genes unveiled their collective regulation of more than 1000 genes, mainly involved in the protein degradation (Fig. 2k, l). To further characterize the interplay between GR, LSD1 and NRF1 on gene regulation, we performed small interfering RNA (siRNA)-mediated knock-down of these factors in C2C12 myotubes. Notably, while reduced NRF1 expression did not alter GR and LSD1 levels (Supplementary Fig. 2i), silencing of any of these factors led to approximately a 50% decrease in the expression of the GR targets Ddit4 and Fbxo31 (Fig. 2m). Together, these results show that LSD1 is instrumental for the interaction between GR at enhancers and NRF1 at promoter regions to stimulate target gene expression in skeletal muscles at physiological GC levels.

The GR/LSD1 complex promotes starvation-induced muscle atrophy

To determine whether LSD1 controls GR transcriptional activity at high endogenous GC levels, we performed a starvation challenge that activates the hypothalamic-pituitary-adrenal (HPA) axis and stimulates the production of GC by the adrenal gland. As shown in Fig. 3a, LSD1 and GR interaction is maintained in gastrocnemius muscles after 12 and 24 h of fasting. To characterize LSD1 function in skeletal muscles during food deprivation, we generated LSD1^(i)skm-/- mice, in which LSD1 was selectively ablated in myofibers at adult stage using the tamoxifen-dependent CreER^T2 system²⁹ (Supplementary Fig. 3a−c) to avoid potential developmental effect of the mutation. After 48 h of fasting, a similar reduction in body and spleen mass was observed in control, GR^(i)skm-/- and LSD1^(i)skm-/- mice, while a more pronounced decrease in white adipose tissue (WAT) mass was noted in the mutant groups relative to the control ones (Fig. 3b and Supplementary Fig. 3d). H&E staining of epididymal WAT revealed a reduced lipid droplet size in GR^(i)skm-/- and LSD1^(i)skm-/- mice compared to controls (Supplementary Fig. 3e). While after a 48 h starvation control mice exhibited decreased muscle strength accompanied by a significant reduction of the mass of gastrocnemius, tibialis and quadriceps fast-switch muscles, and of gastrocnemius cross-sectional area (CSA), these differences were not observed in GR and LSD1 mutant mice (Fig. 3b−e and Supplementary Fig. 3d, f−h). Of note, the mass of slow-twitch soleus muscles was unaffected by starvation (Fig. 3b and Supplementary Fig. 3d), in agreement with former studies^27,30,31.

**Fig. 3: LSD1 is required for starvation-induced muscle atrophy.**

Next, we assessed the impact of GR and LSD1 loss on anabolic and catabolic pathways upon food deprivation. Phosphorylation of MTOR and its downstream effector, EIF4EBP1 (hereafter named 4E-BP1), was decreased in starved control mice. In contrast, MTOR and 4E-BP1 phosphorylation levels were not affected by food deprivation in GR^(i)skm-/- and LSD1^(i)skm-/- mice, suggesting that protein synthesis is not reduced in mutant mice (Fig. 3f, g and Supplementary Fig. 3i−k). In addition, transcript levels of the TORC1 negative regulator Ddit4 were strongly increased in starved control mice, but not in mutants (Fig. 3h and Supplementary Fig. 3l), thus suggesting that GR and LSD1 decrease TORC1 activity through DDIT4 in myofibers. To further investigate the molecular pathways controlling starvation-induced muscular atrophy, transcript levels of genes involved in protein degradation were analyzed by RT-qPCR in gastrocnemius muscles. Myostatin expression, which is stimulated during muscle atrophy^32,33,34,35, was more than 3-fold induced by food deprivation in control mice, but not in mutants, thus demonstrating that starvation-induced myostatin expression is myofiber GR and LSD1-dependent (Fig. 3h and Supplementary Fig. 3l). In addition, FOXO3A and GSK3B, which stimulate catabolism, were activated by dephosphorylation in fasted control mice. In contrast, these two factors were mainly found in their inactive form in GR^(i)skm-/- and LSD1^(i)skm-/- mice (Fig. 3f, g and Supplementary Fig. 3i−k). In agreement, transcript levels of Ubiquitin C (Ubc), Atrogin1 (Fbxo32) and Murf1 (Trim63) from the ubiquitin-proteasome system (UPS) were strongly induced by food deprivation in control mice, contrary to mice lacking GR or LSD1 in myofibers (Fig. 3h and Supplementary Fig. 3l), showing that GR and LSD1 in myofibers are required for the induction of genes involved in protein degradation. Moreover, even though LC3I/II and p62 protein levels were similar among genotypes, the expression of Bnip3, Cathepsin L (Cstl) and Gabaralp1 from the autophagy pathway was higher in starved control mice, but not induced in GR^(i)skm-/- and LSD1^(i)skm-/- mice (Fig. 3f, g and Supplementary Fig. 3i−k). Together, these data show that GR and LSD1 in myofibers control a similar transcriptional repertoire involved in food deprivation-induced impairment of protein synthesis and the induction of protein degradation. In agreement, ultrastructural analysis of gastrocnemius muscles revealed disruptions of myofibrils in more than 60% of the sarcomeres after starvation of control mice, with loss of myofilaments, rupture of Z-lines and enlarged sarcoplasm, whereas less than 20% of the sarcomeres were damaged in muscles of LSD1^(i)skm-/- and GR^(i)skm-/- mice (Fig. 3i and Supplementary Fig. 3m). Taken together, these results show that myofiber GR and LSD1 are required for starvation-induced muscle atrophy.

To investigate the molecular mechanism by which LSD1 and GR promote starvation-induced muscle wasting, we determined their cistrome 24 h following food deprivation. We observed an increased GR recruitment on chromatin after fasting (from 14,108 to 37,783 peaks, Fig. 4a, b and Supplementary Fig. 4a, b), and most genes bound by GR in fed condition were also bound upon fasting (Supplementary Fig. 4c). The genes to which GR was de novo recruited after food deprivation were associated with calcium signaling and proteasome system among other pathways (Supplementary Fig. 4d). Surprisingly, LSD1 recruitment to chromatin was markedly decreased after 24 hours of food deprivation, from 16,616 to 692 peaks (Fig. 4a, b, Supplementary Fig. 4a, b), despite similar LSD1 protein levels in skeletal muscles of mice fed and fasted for 12 to 48 h (Fig. 4c, d).

**Fig. 4: The GR/LSD1 complex is required to trigger the expression of genes involved in starvation-induced proteolysis upon food deprivation.**

To determine the kinetics of GR and LSD1 recruitment during starvation, we performed ChIP-qPCR analysis at 0, 3, 6, 9 and 24-h of food deprivation. While the association of GR with GBSs at enhancers of anti-anabolic (Pik3r1) and catabolic (Ddit4 and Trim63) genes was unaffected by food deprivation, LSD1 recruitment to these sites was increased at 3 h and subsequently decreased at 6 h (Fig. 4e), indicating that LSD1 plays a role at the early stage of starvation. Importantly, ChIP-qPCR analysis revealed that the abundance of the repressive histone mark H3K9me2 already reduced at 3 h of food deprivation, when LSD1 is still present at the chromatin (Fig. 4e). H3K9me2 levels remained low at the various loci beyond 6 h of starvation, indicating that LSD1 demethylates H3K9 within the first 3 h following food deprivation, leading to the derepression of its target genes (Fig. 4e). Of note, GR and LSD1 were not enriched at the Pax7 negative control locus, and the levels of H3K9me2 were not modulated by food deprivation at this site. In line with these data, the abundance of H3K9me1 and H3K9me2 was reduced at LSD1-bound loci, following a 24-h food deprivation, as exemplified by the Tfcp2, Mtch1, Calm and Rap2b loci (Fig. 4a, b). Thus, these data strongly indicate that LSD1 demethylates H3K9 at genes associated with muscle atrophy within first 3 h of food deprivation to promote their transcription. In agreement, RT-qPCR analysis confirmed that the transcript levels of “atrogenes” were stimulated by more than 2-fold 12 h following food deprivation to reach 10-fold at 24 h and 20-fold at 48 h (Supplementary Fig. 4e).

Given that the LSD1 enzymatic activity depends on the metabolic co-factor FAD, we assessed FAD levels in muscle tissue at various times of food deprivation, and found that they declined by 30% at 3 h and by 50% at 24 h (Supplementary Fig. 4f), potentially leading to decreased LSD1 demethylase activity.

Altogether, our results provide evidence that the GR/LSD1 complex triggers the expression of starvation-induced proteolysis genes in skeletal muscles, at least in part via the demethylation of H3K9 at LSD1-bound genomic locations.

The GR/LSD1 complex mediates DEX-induced muscle atrophy

To determine whether LSD1 also contributes to GR activity in the presence of pharmacological levels of synthetic GR ligands, mice were intraperitoneally injected with dexamethasone (DEX) at 10 mg/kg/day for 3 days. Such a treatment decreased fast-twitch muscle weight and strength in control mice, in agreement with previous reports^27,30,31, but not in LSD1^(i)skm-/- and GR^(i)skm-/- littermates (Fig. 5a, b and Supplementary Fig. 5a, b). In agreement, the transcript levels of genes involved in autophagy and the proteasome system were induced in DEX-treated control muscles, but not in those where GR or LSD1 were depleted (Fig. 5c and Supplementary Fig. 5c). In addition, whereas DEX did not affect LC3I/II and p62 levels in muscles of control mice, we noticed an upregulation in protein degradation pathway activity, as revealed by decreased phosphorylation of FOXO3A and GSK3B (Fig. 5d, e and Supplementary Fig. 5d−f), associated with a reduced activity of anabolic regulators MTOR and 4E-BP1 (Fig. 5d, e and Supplementary Fig. 5d−f). This effect was not observed in DEX-treated LSD1^(i)skm-/- and GR^(i)skm-/- mice, showing that DEX-induced expression of genes involved in catabolism and DEX-impaired expression of genes involved in protein synthesis are myofiber GR- and LSD1-dependent.

**Fig. 5: LSD1 is required for dexamethasone-induced muscle wasting.**

Of note, GR and LSD1 protein levels decreased within 24 h of DEX treatment, but returned to basal levels at 72 h (Fig. 5f). At this time point, LSD1 interacted with GR and NRF1 in skeletal muscle nuclear extracts of mice treated with vehicle or DEX (Fig. 5g). GR and LSD1 binding to the enhancer GRBS of Trim63 and Ddit4 in skeletal muscles was increased after a 72 h DEX treatment of control mice, but not of LSD1^(i)skm-/- mice (Fig. 5h), showing that LSD1 contributes to DEX-stimulated GR recruitment to cognate binding sites.

Together, our data show that LSD1 is required for GR transcriptional activity at pharmacological GC levels.

LSD1 demethylase activity is required for GR-dependent muscle wasting, but is dispensable for glucocorticoid anti-inflammatory activity

To further investigate the molecular features of the GR/LSD1 complex, we analyzed LHCN-M2 human myotubes. Immunocytofluorescence analysis showed that LHCN-M2 cells express both GR and LSD1, and that the two factors are mainly located in the nucleus (Fig. 6a). Similar to what we observed in mouse muscles, co-immunoprecipitation experiment showed that GR, LSD1 and NRF1 interact in LHCN-M2 nuclear extracts (Fig. 6b).

**Fig. 6: Effect of LSD1 inhibition on dexamethasone-treated LHCN-M2 cells.**

In agreement with in vivo data, DEX treatment enhanced the transcript levels of genes involved in anti-anabolic and catabolic pathways in LHCN-M2 cells (Fig. 6c). To determine whether LSD1 activity is required for this induction, myotubes were treated with the LSD1-specific nanomolar affinity inhibitor CC-90011 (also named Pulrodemstat besylate, QC6688³⁶). Our RT-qPCR data revealed that a co-treatment with CC-90011 abrogated DEX-dependent atrogene induction, thus showing that inhibition of LSD1 activity counteracts DEX effects in tissue culture. We thus aimed at characterizing the effects of this inhibitor in a mouse model.

To investigate whether pharmacological LSD1 inhibition impacts DEX-induced muscle atrophy, we analyzed mice co-treated for 72 h with DEX and/or CC-90011. Remarkably, whereas muscle strength and fast-twitched muscle mass were decreased by more than 20% in DEX-treated mice, they were decreased by less than 10% in mice co-treated with the inhibitor (Fig. 7a, b). GR recruitment to the enhancer of Trim63 and Ddit4 was reduced upon LSD1 inhibition (Fig. 7c), and RT-qPCR analysis revealed that DEX-induced transcript levels of genes involved in UPS and autophagy were blunted in the presence of the LSD1 inhibitor (Fig. 7d), showing that LSD1 demethylase activity is required to mediate DEX-dependent muscle wasting. Note that a 3-days treatment with CC-90011 alone had no major impact on muscle mass nor on the expression of GR target genes (Fig. 7a, b, d).

**Fig. 7: LSD1 inhibition prevents dexamethasone-induced muscle wasting without affecting glucocorticoid anti-inflammatory activities.**

Importantly, spleen weight similarly decreased in response to DEX treatments, in the presence or absence of CC-90011 (Fig. 7a), and its immune cell composition was evenly impaired (Supplementary Fig. 6a, b). Moreover, DEX reduced the total blood count of leukocytes, which was mainly due to an 80% reduction in lymphocyte numbers, leading to a shift in the composition in white blood cells towards a higher percentage of neutrophil, that was not impacted by CC-90011 (Fig. 7e).

To further determine whether the treatment with CC-90011 affects DEX-induced anti-inflammatory activities, naive lymphocyte T helper (Th) cells were isolated from lymph nodes of wild-type mice and polarized towards Th0 or Th17 conditions. Flow cytometry analysis confirmed that the proportion of IL-17 expressing cells was strongly enhanced in Th17 compared with Th0 cells (57% versus 1.2%, respectively). Notably, IL-17 production was 3-times reduced in cells treated with DEX, either alone or in combination with CC-90011 in Th17 cells (Fig. 7f), showing that LSD1 inhibition does not affect DEX anti-inflammatory activity in this cell type. Taken together, these results show that the LSD1 inhibitor CC-90011 limits DEX-induced muscle wasting without impairing anti-inflammatory activities in mice in physiological conditions.

CC-90011 does not impair GC anti-inflammatory activities in a mouse model of colitis

To investigate the effects of LSD1 inhibition on GC anti-inflammatory effects in pathological conditions, we employed a mouse model of inflammatory bowel disease (IBD). Mice were treated with 3% dextran sulfate sodium (DSS) in drinking water over a six-day period, and DEX and/or CC-90011 were administrated from the 3rd to the 5th day of colitis, as described³⁷ (Supplementary Fig. 7a). As shown in Fig. 8a, b, water consumption and weight loss were similar for all DSS-treated mice. They all presented diarrhea and/or hematochezia, which was partially prevented by DEX and/or CC-90011 (Supplementary Fig. 7b, c). Importantly, the DSS-induced reduction of colon length was less prominent in mice treated with DEX, in combination or not with CC-90011, whereas CC-90011 alone had no effect (Fig. 8d, e). In addition, the induction of IL-6 transcript levels in the colon of DSS-treated mice was reduced by treatment with DEX + /- CC-90011 (Fig. 8f). Importantly, whereas colon of mice treated with DSS presented an important infiltration of immune cells (red arrows) associated with a severe epithelial cell exfoliation at the apical pole of the crypts (black arrows), DEX + /- CC-90011 treatment markedly alleviated these damages (Fig. 8g and Supplementary Fig. 7c), thereby showing that CC-90011 does not impair DEX therapeutic effects on colon inflammation. Notably, mice treated only with CC-90011 presented an intermediate phenotype between DSS- and DSS + DEX-treated mice.

**Fig. 8: LSD1 inhibition does not impair dexamethasone-induced improvement of experimental colitis symptoms.**

DEX treatment, both with and without CC-90011 also reduced DSS-induced spleen enlargement (Fig. 8h). It led to a shift in immune cell composition, characterized by decreased proportion of lymphocytes and in particular lymphoid CD4+ cells, an increased in CD11b+ cells mainly due to neutrophils, even though the number of monocytes and macrophages was reduced (Fig. 8i and Supplementary Fig. 7d). Notably, CC-90011 alone also prevented spleen hypertrophy, without affecting the proportion of immune cell populations (Fig. 8h, i and Supplementary Fig. 7d). Complete blood count (CBC) analysis revealed that all DSS-treated mice presented a severe normocytic anemia (Fig. 8j), most probably due to hematochezia. DEX + /- CC-90011 significantly reduced the number of lymphocytes by 70%, while increasing neutrophils and monocytes by 60%, whereas CC-90011 alone had no major effect on white blood cell proportions (Fig. 8j).

In agreement with Fig. 7a, even though the mass of fast-twitch muscles was decreased by DEX-treatment, co-treatment with CC-90011 reduced this diminution (Fig. 8k), thereby showing that CC-90011 does not impair DEX anti-inflammatory activity, while preventing GC-induced muscle atrophy.

Together, our data show that LSD1 inhibition impairs DEX-induced muscle wasting without affecting its anti-inflammatory activities in a model of acute inflammation.

Discussion

GC-induced iatrogenic effects represent a severe clinical burden due to their propensity to induce muscle atrophy, thereby elevating the risks of falls and fractures. Despite extensive endeavors to synthesize GC analogs with anti-inflammatory properties dissociated from adverse effects, such compounds have not been obtained so far. Here we provide compelling evidence that LSD1 acts as a GR co-activator in mediating muscle atrophy, and that LSD1-specific inhibition counteracts muscle wasting provoked by GC without affecting their anti-inflammatory activities.

Our cistrome analyses uncovered about 16,000 LSD1 binding sites, with an even distribution across TSS, intronic and intergenic locations, as described in other tissues^36,38. Taking advantage of genetically engineered mice, in which LSD1 is selectively ablated in myofibers, we demonstrate that LSD1 recruitment to these sites is highly myofiber-specific, and directly coordinates the expression of ~1600 genes. Importantly, we unveiled a cooperation between GR and LSD1, the latter being recruited to muscle enhancers in a spatially constrained domain centered around GR binding sites. The comparison between GR and LSD1 cistrome datasets showed that LSD1 is recruited to most genes targeted by GR. Moreover, transcriptomic analysis revealed that in the absence of either GR or LSD1, half of the genes bound by both factors is down-regulated. Collectively, these data demonstrate that LSD1 potentiates GR activity to control gene expression in myofibers. Recently, LSD1 has been shown to transactivate the androgen receptor (AR), another member of oxosteroid receptor family that coordinates muscle homeostasis³⁹. AR/LSD1 interaction is enhanced when AR presents CAG (poly-Q) expansions causing spinobulbar muscular atrophy (SBMA)³⁹, suggesting that LSD1 exhibits distinct functional roles according to the oxosteroid receptor to which it is associated.

We previously showed that NRF1-bound promoters are topologically associated with GR-bound enhancers to regulate gene expression in mouse skeletal muscles¹⁵. In this study, we explored the interaction between GR, LSD1 and NRF1 in skeletal muscle gene regulation. ChIP-seq identified ~3000 NRF1 binding sites primarily at promoter regions linked to genes involved in proteolysis and oxidative phosphorylation. Furthermore, we provide evidence that LSD1 interacts with GR and NRF1, and that these interactions are required to stimulate gene expression, thereby establishing a functional link between GR at enhancer regions and NRF1 at promoter sites in myofibers. Using recombinant proteins, we provide evidence that the interaction between LSD1 and NRF1 is direct. As it was previously shown that GR and LSD1 also directly interact, these data indicate that GR, LSD1 and NRF1 are part of a macromolecular complex that promotes gene transcription.

Our previous studies revealed that LSD1 cooperates with NRF1 to control metabolic properties of adipocytes, by promoting the expression of most genes encoding subunits of the mitochondrial respiratory chain, and of Tfam, the major regulator of mitochondrial biogenesis³⁸. In muscles, OXPHOS and fatty acid metabolism pathways were not found as enriched gene networks upon GR and LSD1 ablation. Instead, we unveiled genes involved in muscle mass regulation, thereby showing that the LSD1/NRF1 complex holds specific functions according to the cell type and the transcription factors with which it is associated. Interestingly, our motif search indicates that LSD1 might interact with some other transcription factors, such as MEF2C or SIX2 at enhancer regions, suggesting that LSD1 might hold other functions in myofibers that remain to be determined.

Importantly, GR and LSD1 cooperate to control gene expression in skeletal muscles in the presence to both low and high GC levels, and the GR/LSD1 complex is required to promote fasting- and DEX-induced atrophy of fast-twitched muscle fibers. Even though GR and LSD1 are expressed and co-localize in every type of muscle from the limb, their glucocorticoid-dependent action on muscle wasting is clearly predominant in type-2 fibers, suggesting that an additional critical co-regulator is missing in slow-twitched muscles, which would be interesting to characterize.

Our results reveal that the molecular mechanism by which GR and LSD1 control gene expression differs upon starvation or pharmacological treatment. Both GR^(i)skm-/- and LSD1^(i)skm-/- mice are resistant to fasting induced muscle wasting. In addition, the major signaling pathways controlling protein degradation, such as ubiquitin proteasome system and autophagy, are similarly impaired in skeletal muscles of both GR^(i)skm-/- and LSD1^(i)skm-/- mice. Furthermore, as we provide evidence that GR and LSD1 interact during fasting, our data show that most pathways involved in fasting-induced muscle wasting and impaired by LSD1 ablation are GR-dependent. Muscle wasting can also be caused by additional pathways, including insulin or IGF1 signaling that activate AKT/MTOR cascade. Upon muscle atrophy, this signalization is impaired, thereby contributing to decreased protein synthesis. All these cascades are largely interconnected, as GR negatively regulates the AKT/MTOR pathway. However, since the starvation-induced loss of insulin signaling is not due to muscle defects, it is unlikely that myofiber LSD1 has any contribution in this process by interacting with additional transcription factors. ChIP experiments unveiled that food deprivation promotes GR binding to additional locations. Even though GR and LSD1 interact after a 24 h fast, LSD1 recruitment at GR-bound genes is impaired after 6 h of food deprivation. In the absence of LSD1 or GR, muscle mass was not reduced by food deprivation, showing the GR/LSD1 complex is crucial in promoting muscle wasting during food deprivation. Note that epididymal fat mass was even more reduced in LSD1^(i)skm-/- and GR^(i)skm-/- mice than in controls, most probably as a compensatory mechanism to maintain glucose levels. Together, these data show that LSD1 is required to promote GR-dependent muscle atrophy.

In response to DEX treatment, LSD1 and GR levels declined at 24 h, and went back to basal levels after 3 days. Similar observations were made for GR in spleen³¹, suggesting a common DEX-dependent regulatory mechanism of GR expression in various tissues. Our data show that DEX promotes muscle wasting of fast-twitched myofibers in control mice, but not in GR^(i)skm-/- mice, in agreement with previous reports³¹, nor in LSD1^(i)skm-/- mice, indicating that the GR/LSD1 complex is required for DEX-induced muscle atrophy. However, in contrast to food deprivation, GR and LSD1 binding to enhancer regions of target genes was induced after DEX treatment. Moreover, LSD1 ablation impaired DEX-induced GR recruitment at chromatin. Our genetic data were further supported by pharmacological inhibition of LSD1. These results are in sharp contrast with those of Araki et al.⁴⁰, who recently reported that LSD1 loss enhances GC-induced muscle atrophy. They investigated LSD1 mutant mice in which exons 5 and 6 encoding for the C-terminal part of the SWIRM domain were deleted, potentially resulting in a C-terminal truncated protein encompassing the N-terminal, that could not be detected with the anti-LSD1 antibody ab17721, that is directed against LSD1 C-terminal region. Thus, as the N-terminal SWIRM region is key for the interaction with co-factors^41,42, a truncated LSD1 protein might have dominant negative effects. In contrast, in our study LSD1 ablation, determined using a N-terminal antibody (targeting aa 35-141), was assessed by deleting exon 1, leading to a frame shift in exon 2 that generates a stop codon, thereby preventing protein translation. An additional explanation for the observed discrepancies may originate from the overall design of the experiment. Indeed, the authors initiated the DEX treatment concomitants with the Tamoxifen administration for inducing Lsd1 ablation. This approach presents two key issues, which are (1) an incomplete deletion of LSD1 protein and (2) a crosstalk between LSD1 and the two hormones^{43,44,45,46,47}. Thus, the combination of our knock-out mouse models and the use of a LSD1-specific inhibitor reinforce our conclusions showing that LSD1 promotes GR-dependent gene expression.

In the presence of both natural and synthetic elevated GC levels, LSD1 demethylase activity is crucial for the action of the GR/LSD1 complex on gene expression. Even though LSD1 recruitment at GR-bound genes is reduced 6 h post-food deprivation, this time lapse is sufficient to demethylate H3K9 at anti-anabolic and catabolic genes, thereby promoting their expression. Interestingly, we found that the decrease in FAD content follows that of H3K9 methylation levels. Even though it is commonly admitted that FAD is required for LSD1 activity by binding to the amine oxidase-like (AOL) domain^17,48,49,50, to our knowledge, it was never investigated whether the presence of FAD is mandatory for LSD1 binding to the chromatin. We can thus speculate that upon starvation, FAD content becomes limiting, thereby affecting LSD1 folding and activity, ultimately leading to its release from the chromatin.

Previous studies have identified several LSD1 inhibitors, including CC-90011, Tranylcypromine, ORY1001 and GSK2879552^51,52. CC-90011 binds rapidly and reversibly to the FAD cofactor within the LSD1 pocket and inhibits its activity, leading to changes in chromatin structure and gene expression²⁵. IC50 of CC-90011 is of 0.25 nM, whereas Tranylcypromine irreversibly inhibits LSD1 with an IC50 value of 20.7 µM. This distinction underscores CC-90011 as a highly potent, selective, reversible and orally active LSD1 inhibitor. We show that CC-90011 strongly attenuates DEX-induced muscle wasting in mice, without impairing anti-inflammatory activities in physiological conditions and in a model of IBD. CC-90011 molecular function is achieved by preventing LSD1 recruitment to chromatin, thereby impacting GR transcriptional activity in muscle tissue. We also establish that DEX effectively alleviates colitis symptoms induced by DSS, confirming its anti-inflammatory efficacy. Notably, co-administration of the LSD1 inhibitor CC-90011 with DEX does not impair DEX anti-inflammatory effects, showing that LSD1 inhibition can selectively reduce GC-induced muscle atrophy without affecting their therapeutic benefits. This finding is crucial for conditions like IBD, for which GC are the first line of treatment. Furthermore, we show that CC-90011 and DEX combination therapy does not adversely affect immune cell dynamics, indicating a promising approach to optimize inflammatory condition treatments by balancing anti-inflammatory benefits with muscle protection. It is to note that a treatment with CC-90011 alone limits DSS-induced spleen hypertrophy and slightly improves colon inflammation. Since CC-90011 is currently under clinical trials for AML, SCLC and solid tumor treatment⁵³, and counteracts DEX-induced catabolism of human myofibers, this compound is a promising candidate to attenuate GC muscular side effects in patients.

Together, by combining functional phenotypic and genome-wide analyses, we provide evidence that LSD1 acts as a GR co-activator to mediate GC-induced muscle atrophy. These findings shed insight into the molecular mechanisms underlying the iatrogenic effects of GC. Moreover, we demonstrate that pharmacological inhibition of LSD1 circumvents GC iatrogenic effects in skeletal muscles, while retaining their anti-inflammatory properties. Thus, our study opens perspectives to improve long-term GC treatments.

Methods

Mouse studies

To selectively ablate LSD1 in skeletal muscle fibers, LSD1^L2/L2 floxed mice, in which exon 1 is flanked with 2 LoxP sites⁵⁴, were intercrossed with HSA-Cre mice⁵⁵, to generate control (LSD1^L2/L2) and LSD1^skm-/- mutant male mice. Alternatively, LSD1^L2/L2 mice were intercrossed with HSA-CreER^T2 mice²⁹, and seven-week-old LSD1^L2/L2 control male mice and HSA-CreER^T2/LSD1^L2/L2 sex-matched somatic pre-mutant littermates were intraperitoneally injected with Tamoxifen (1 mg/mouse/day) for 5 days to generate control (Ctrl) and LSD1^(i)skm-/- mutant mice, respectively, as described²⁹. GR^(i)skm-/- mice were previously described¹⁵. All mice were on a C57Bl/6J background. Primers used for genotyping are listed in Supplementary Table 1.

Mice were maintained in a controlled temperature (19−23 °C) and humidity (40−60%) animal facility, with a 12-h light/dark cycle. Standard rodent chow (2800 kcal/kg, Usine d’Alimentation Rationelle, Villemoisson-sur-Orge, France) and water were provided ad libitum. Breeding and maintenance of mice were performed according to institutional guidelines. All experiments were done in an accredited animal house, in compliance with French and EU regulations on the use of laboratory animals for research. Intended manipulations were approved by the Ethical committee (Com’Eth, Strasbourg, France) and authorized by the French Research Ministry (MESR), conforming to the 2010/63/EU directive (APAFIS numbers: 2015-26, 37660, 39468 and 45167).

Food deprivation experiments were initiated one month after the last tamoxifen injection. Dexamethasone (Sigma; product D1756-1G) was dissolved at 20 mg/ml in EtOH, diluted at 3 mg/ml in oil, and intraperitoneally administrated at 10 mg/kg. LSD1 inhibitor CC-90011 was administrated per os at 5 mg/kg in 0.5% methylcellulose (Sigma; product M0512-110G; viscosity, 4000 centipoises [cP]). Both compounds were administrated one month after the last tamoxifen injection for one or three days.

Colitis was induced by 3% DSS (MP Biomedicals, France) added to the drinking water for 6 days. Daily assessments included water intake, body weight change, and clinical signs to calculate a clinical disease score. Each signal presented by the animal corresponded to one point and the sum of points for each mouse generated a clinical score. Dexamethasone and CC-90011 were administered daily from the 3rd to the 5th day of colitis at 10 mg/kg and 5 mg/kg, respectively.

CBC analysis was performed by the ICS phenotyping platform⁵⁶. Limb grip strength was measured with a Grip Strength Meter (Bioseb), with three consecutive tests per session and recording mean and maximal values for each mouse¹⁵.

Mice were euthanized by cervical dislocation, and tissues were immediately harvested, weighed, and either frozen in liquid nitrogen or processed for biochemical and histological analysis.

Histological analysis

Hematoxylin and eosin staining and ultrastructural analyses were performed as described⁵⁷. Images were acquired using a NanoZoomer S210 scanner (Hamamatsu) and a Mega View III camera (Soft Imaging System), respectively. Immunofluorescence analysis was performed as described^57,58 with anti-LSD1 (C-terminal, R. Schüle, #3544, 1:500) and anti-GR (Santa Cruz, sc393232, 1:500) antibodies. Rabbit and mouse IgGs (Santa Cruz, sc2357, sc 2025, 1:1000) were used as control. Sections were observed under Leica epifluorescence and confocal microscopes.

Fiber cross-sectional area measurements

Muscle cross-sections were stained with dystrophin (Abcam, ab15277, 1:500) to mark the sarcolemma surrounding each fiber. CSAs were quantified using the FIJI image-processing software as described⁵⁸. In brief, individual fibers were identified based on the intensity and continuity of the dystrophin-stained sarcolemma surrounding each fiber by segmentation. Areas were measured after background subtraction, automated thresholding and analyzed with the Qupath software.

Flavin adenine dinucleotide (FAD) measurement

The assessment of FAD levels in skeletal muscles was conducted utilizing the FAD Assay Kit (ab204710, Abcam) in accordance with the manufacturer’s guidelines. Briefly, skeletal muscles were lysed in ice-cold FAD Assay Buffer, and deproteinization with Perchloric acid/potassium hydroxide. FAD levels were determined through a colorimetric assay. FAD measurements were carried out concurrently and standardized to RNA concentrations, as ascertained by the NanoDrop spectrophotometer (Thermo Fisher).

FACS analysis

Spleens were processed into a sterile 35 mm culture dish with PBS containing 1 mM EDTA, using a syringe plunger to crush the tissue. The cell suspension was filtered through a 70 µm strainer to remove clumps and washed with PBS. Cells were incubated for 10 min on ice with anti-CD45, anti-CD11b, anti–Ly-6G (Gr-1), anti-Ly-6C, and anti-F4/80 antibodies for the myeloid panel, or with anti-CD3ε, anti-CD4, anti-CD8a for the T-cells panel (Supplementary Table 4). Antibodies dilutions were prepared in DMEM (4.5 g/l glucose, 1% Penicillin/Streptomycin solution, and 2% bovine serum albumin, without phenol red). After washing, cells were analyzed using a BD LSR II flow cytometer and the FlowJo software.

Cell culture

LHCN-M2 myoblasts⁵⁹ were kindly gifted by Dr. Jocelyn LAPORTE (IGBMC, Strasbourg University, France). Cells were grown in a 4:1 ratio of Dulbecco’s modified Eagle medium (DMEM, Gibco, Cat # 10566016)/M199 (Gibco, Cat# 31150022) medium, supplemented with 15% heat-inactivated fetal calf serum (FCS), fetuin (25 µg/mL), human insulin (5 µg/mL), human EGF (5 ng/mL), human bFGF (0.5 ng/mL) and gentamycin (40 µg/mL). After reaching 80% confluency, cells were differentiated in DMEM (4.5 g/l glucose, 2% of heat-inactivated horse serum (HS), 1% Penicillin/Streptomycin solution) for 5 days. Cells were treated with CC-90011 (100 nM in DMSO) and/or DEX (100 nM in EtOH) for 24 h. Immunocytofluorescence assay was performed by incubating fixed LHCN-M2 cells with anti-LSD1 (R. Schüle, #3544, 1:500) and anti-GR (Invitrogen, MA1-510, 1:500) antibodies. Observations were made under a Leica confocal microscope.

C2C12 myoblasts (ATCC CRL-1772) were grown in DMEM (1 g/L glucose and 20% FCS). To induce myogenesis, the medium was switched to DMEM (1 g/L glucose and 2% HS) for 5 days. Cells were transfected with 30 pmol siRNA against GR (5’-GCUUUGCUCCUGAUCUGAUUAUUAA-3’), Lsd1 (5′-CCCAAAGAUCCAGCUGACGUUUGAA-3′), Nrf1 (5’-CCACACACAGUAUAGCUCAUCUCGU-3’), or a scrambled control (5’-AGGUUCCGUGUACGUAAGACAAACU-3’) (Invitrogen) using Lipofectamine RNAimax (Invitrogen) according to the manufacturer’s instructions, two days before and one day after myogenic induction.

RNA extraction and analysis

Muscles, C2C12 and LHCN-M2 cells were homogenized in TRIzol reagent (Life Technologies, Darmstadt, Germany). RNA was isolated using a standard phenol/chloroform extraction protocol, and quantified by spectrophotometry (Nanodrop, Thermo Fisher). 2 µg of total RNA underwent reverse transcription using SuperScript IV (Life Technologies) with oligo(dT) primers, according to the supplier’s protocol. cDNA was diluted hundred times and quantitative PCR (qPCR) was performed with a Lightcycler 480 II (Roche) using the SYBR® Green PCR kit (Roche) according to the supplier’s protocol (2 µl cDNA, 4.8 µl H2O, 5 µl Syber Green 2x mix and 0.2 µl of 100 µM primer mix). Primers are described in Supplementary Table 2. 18 S and RPLP0 were used as internal controls for mouse and human samples, respectively. Data were analyzed using the standard curve⁶⁰ and ∆∆Ct⁶¹ methods. Primer efficiency was calculated as Eff = 100*10^ ((−1/The Slope Value)−1).

For RNA-seq, RNA integrity was confirmed by Bioanalyzer. cDNA library was prepared, and sequenced with the standard Illumina protocol (HiSeq 2000, single-end, 50 bp) following the manufacturer’s instructions. Image analysis and base calling were performed using RTA 2.7.7 and bcl2fastq 2.17.1.14. Adapter dimer reads were removed using DimerRemover (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC). FastQC 0.11.2 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was used to evaluate the quality of sequencing. Reads were mapped to the mouse mm10 genome (NCBI Build 38) using htseq-count (Version 0.9.1)⁶². Only uniquely aligned reads were retained for further analyses. Gene expression was quantified with HOMER. For comparison among datasets, transcripts with more than 50 raw reads were considered. Differentially expressed genes (DEGs) were identified using the Bioconductor libraries DESeq2⁶³ with a p < 0.05 and a fold change excluding values between 0.77 and 1.3. Pathway analysis was done using WebGestalt⁶⁴ using the Over-Representation Analysis (ORA) method and a p < 0.05. Heatmaps of normalized expression values were generated with Cluster 3.0⁶⁵ and MORPHEUS. Genes were clustered according to the hierarchical method (HCL clustering) using gene tree, the Pearson correlation and average linkage.

Muscle nuclei isolation

Nuclei were isolated from mouse skeletal muscles as described⁶⁶. In brief, muscles were homogenized in hypotonic lysis buffer [10 mM HEPES-KOH pH 7.3, 10 mM KCl, 5 mM MgCl2, 0.1% NP-40, 0.1 M PMSF, protease inhibitor cocktail (45 µg/mL; Roche)]. For ChIP-qPCR and ChIP-seq experiments, lysates were fixed with 1% paraformaldehyde (PFA) for 10 min, and neutralized with 125 mM glycine for additional 10 min. After further homogenization with a loose dunce and centrifugation at 1000 g for 5 min at 4 °C, pellets were resuspended in ice-cold hypotonic buffer, sequentially filtered through 70 µm and 40 µm strainers, and centrifuged at 1000 g for 5 min at 4 °C to collect the nuclei.

Cell cytoplasm and nuclei protein extraction

Cells were lysed in 200 μL of Cytosolic buffer [10 mM HEPES, 60 mM KCl, 1 mM EDTA, 0.075% (v/v) NP40, 1 mM DTT, and 1 mM PMSF (pH 7.6)], and incubated on ice for 8 min. After centrifugation at 400 g for 5 min, supernatants were collected as cytosolic fractions. Nuclei pellets were resuspended in 100 μL of nuclear buffer [20 mM Tris HCl, 420 mM NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 1 mM PMSF and 25% (v/v) glycerol (pH 8.0)], and incubated for 10 min on ice. After centrifugation at 15,000 g for 10 min, supernatants were collected as the nuclear fractions.

Protein analysis

To isolate proteins, purified nuclei were resuspended in RIPA buffer [50 mM Tris, pH 7.5, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 5 mM EDTA and protease inhibitor cocktail (45 mg/ml, Roche, 11 873 580 001)] and incubated for 10 min at 4 °C.

For total muscle protein extraction, tissues were grounded in RIPA buffer at 4 °C, centrifuged at 12,000 g for 10 min, and supernatant was retained for further analyses.

For western blot analyses, homogenates were separated in polyacrylamide gels, transferred to Hybond nitrocellulose membranes (Amersham Biosciences), and probed with specific antibodies targeting LSD1 (C-terminal, R. Schüle, #3544, 1:1000), GR (C-terminal, IGBMC, #3249, 1:500), NRF1 (ab55744, Abcam, 1:1000), phospho-mTOR (Ser2448, Cell Signaling, 1:1000), mTOR (Cell Signaling, 1/500), phospho-4E-BP1 (Thr37/46, Cell Signaling, 1/1500), 4E-BP1 (53H11, Cell Signaling, 1:1500), phospho-FOXO3a (Ser318/321, Cell Signaling, 1:1000), FOXO3a (Cell Signaling, 1:1000), phospho-Akt (Thr308, Cell Signaling, 1:1000), Akt1 (2H10, 1:500), phospho-GSK3B (Ser9, 5B3, Cell Signaling, 1:1500), GSK3B (BD Transduction Laboratories, 1:1000), LC3B (GT1187, Genetex, 1:1000), P62 (ab56416, abcam, 1:5000), β-ACTIN (Santa Cruz, sc-4778, 1:5000), α-TUBULIN (IGBMC, 1Tub2A2, 1:5000), and GAPDH (#2118, Cell Signaling, 1:5000). Secondary antibodies conjugated to horseradish peroxidase (Jackson ImmunoResearch, 1:10,000) were detected using an enhanced chemiluminescence detection system (ECLplus, GE Healthcare) and an AI600 imager (GE Healthcare). Protein quantification was assessed by the FIJI/ImageJ distribution software (https://imagej.net/ImageJ)⁶⁷. All uncropped blots and gels are presented in the Source Data file.

For Immunoprecipitation assays, 200 µg of muscle nuclear extracts were incubated with 5 µg of specific rabbit antibodies against GR (N-terminal, IGBMC, #3249), LSD1 (C-terminal, R. Schüle, #3544) or NRF1 (ab175932, Abcam), or control rabbit IgGs (Santa Cruz, sc2357) with Dynabeads protein G (Thermo Fisher Scientific, 10004D) in IP buffer, and processed for western bot analyses⁶⁸. The loading volumes on the gel were adapted to optimize interaction visualization. In brief, the 40 µl obtained after IP of Ab1 were loaded as 10 µl for western blot detection with Ab1 and 30 µl for western blot detection with Ab2. Membranes were incubated with mouse anti-rabbit IgG (L27A9 Conformation Specific, Cell signaling, 1:5000) for 1 h at room temperature before addition of the secondary antibodies following manufacturer’s instructions.

Chromatin immunoprecipitation

ChIP followed by qPCR analysis (ChIP-qPCR) was performed on skeletal muscle nuclear extracts as described⁶⁶, using 5 µg anti-GR (C-terminal, IGBMC, #3249), anti-NRF1 (Abcam, ab175932), anti-LSD1 (C-terminal, R. Schüle, #20752) and anti-H3K9me2 (Active Motif, #39239), or a rabbit IgG (Santa Cruz, sc2357) negative control bound to protein Dynabeads protein G (Thermo Fisher Scientific, 10004D)³⁶. Primers used for ChIP-qPCR are described in Supplementary Table 3.

For re-ChIP assays, after initial overnight immunoprecipitation, beads were washed, incubated in re-ChIP elution buffer for 30 min at 37 °C, and diluted 20-fold with ChIP dilution buffer supplemented with 50 μg BSA and protease inhibitor. A second immunoprecipitation reaction was performed with specific antibodies or control rabbit IgG. Protein–DNA complexes were eluted and reverse cross-linked for analysis⁶⁹.

For ChIP-seq analysis, libraries were prepared from 5 µg GR (C-terminal, IGBMC, #3249), LSD1 (C-terminal, R. Schüle, #20752), NRF1 (Abcam, ab175932), H3K9me1 (Active Motif, #39249) and H3K9me2 (Active Motif, #39239) immunoprecipitated DNA from skeletal muscle nuclear extracts as described⁶⁶. ChIP-seq libraries were sequenced with an Illumina Hiseq 4000 as single-end 50 bp reads, and mapped to the mm10 reference genome using Bowtie 1.1.2⁷⁰. Uniquely mapped reads were retained for further analysis. Reads overlapping with ENCODE hg38 blacklisted region V2 were removed using Bedtools⁷¹. Bigwig files were generated using Homer⁷² software makeUCSCfile script with default parameters and scaled to 1e7 reads. MACS2 (2.2.7.1) algorithm (https://github.com/taoliu/MACS/)⁷³ was used for the peak calling and the appropriate input DNA from each sample was used as control. All peaks with an FDR greater than 0.01 were excluded from further analysis. The genome-wide intensity profiles were visualized using the IGV genome browser (http://software.broadinstitute.org/software/igv/)⁷⁴. HOMER was used to annotate peaks and for motif searches⁷². De novo identified motifs were referred to as follow: R = purine (G or A); Y = pyrimidine (T or C). Genomic features (promoter/TSS, 5’ UTR, exon, intron, 3’ UTR, TTS and intergenic regions) were defined and calculated using Refseq and HOMER according to the distance to the nearest TSS. Clustering analyses were done with the seqMINER software⁷⁵, and clustering normalization was done with the K-Means linear option. Venn diagrams were generated with Venny (https://bioinfogp.cnb.csic.es/tools/venny/). Pathway analysis was performed with WebGestalt using the Over-Representation Analysis (ORA) method⁶⁴.

Parameters were set as default, with the exception of the following: Bowtie (-m 1 -- strata -- best - y - S - l 40), MACS2 [callpeak -- gsize 1.87e9 -- nomodel -- extsize 150 -- broad --keep-dup auto], seqMINER (input bed files normalized to 20 million reads per sample).

ChIP-seq and ChIP-qPCR analyses have been performed on different muscle samples.

In vitro interaction assays

LSD1 cDNA (encoding aa 2-852) was cloned into a pDEST8 vector with a C-terminal hexahistidine tag sequence, and protein was expressed in Sf21 insect cells using the baculovirus technology. NRF1 cDNA was cloned into pET28a vector (Twist Bioscience) with of a hexahistidine tag sequence and expressed in BL21 Escherichia coli. Cells were resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 400 mM NaCl, 10% glycerol, 1 mM CHAPS, 0.1% Nonidet P-40, 1 mM TCEP, 10 mM imidazole), sonicated, and centrifuged at 10,000 g. Supernatants were processed through a HisTrap FF crude column (GE Healthcare), and proteins were eluted with 300 mM imidazole. Further purification was done using a Superdex S200 10/300 column (Cytiva) in a SEC buffer (50 mM Hepes, pH 7.5, 300 mM NaCl, 2 mM MgCl₂, 10% glycerol, 2 mM CHAPS, 0.1% Nonidet P-40, 1 mM TCEP). Protein purity and homogeneity were confirmed by SDS/PAGE.

For immunoprecipitation assays, Dynabeads protein G (Thermo Fisher Scientific, 10004D) were pre-cleaned with SEC buffer, and incubated with 5 µg anti-LSD1 antibody (R. Schüle, #3544) or control rabbit IgG (Pepro Tech, 500-P00-500 UG). Purified LSD1 (1 nmol) was added to the beads, followed by the addition 1 nmol NRF1. The mixture was incubated in SEC buffer at 4 °C for 3 h. Washing steps were carried out in SEC buffer with increasing amount of NaCl (400 mM to 1000 mM). Proteins were eluted in Laemmli buffer and analyzed on an 8% polyacrylamide SDS gel, with 10% of the purified proteins used as an input fraction.

Th cells isolation and differentiation

Th17 polarization was performed as described⁷⁶ with minor changes. Antibodies information is detailed in Supplementary Table 5. Briefly, cells from peripheral and mesenteric lymph nodes of C57BL/6 mice were stained anti-CD16/CD32 blocking antibodies, anti-CD4, anti-CD8, anti-CD44, anti-CD25, anti-NK1.1, and anti-TCRgd antibodies in PBS with 10% heat-inactivated FCS for 15 min on ice. Naïve CD4 T cells (CD4 + , CD8-, CD44lo, TCRgd-, NK1.1-) were sorted using a FACS ARIA Fusion (BD Biosciences) with a purity >98%. Naive CD4 T cells (4×10⁴/well) were then activated with anti-CD3 (clone 2C11) and anti-CD28 (clone 37.51) antibodies, both pre-coated overnight in PBS at 4 °C on a nunc-immuno 96 well plate, with (Th17 conditions) or without (Th0 conditions) IL-6 (10 ng/ml) and TGFb1 (0.125 ng/ml) in the presence of neutralizing anti-IFNg and anti-IL-4 Abs (10 µg/ml each) in Iscove’s Modified Dulbecco’s Medium (IMDM) containing 10 % inactivated FCS, Glutamax, 10 mM Hepes, sodium pyruvate and Beta-mercaptoethanol (200 µl/well). After 3 days of culture in the presence of vehicle, DEX (100 nM) and/or CC-90011 (100 nM), cells were stimulated with phorbol-12-myristate-13-acetate (PMA) plus ionomycin (0.5 µg/ml each) and GolgiPlug (1/1000) for 2 h, stained with the BD HorizonTM fixable viability stain 780 Zombie, then with anti-CD4 antibody, fixed and permeabilized using the Intracellular Fix & permeabilization set (eBioscience) and stained with anti-IL-17 and anti-IFNg antibodies. Protein expression was analyzed on live CD4 + T cells using a flow cytometer symphony A1 (BD Biosciences).

Statistical analysis

No statistical method was used to determine animal’s sample size. Sample size was chosen based on experience with the used experimental models in the field of cell biology and animal experiments. The number of samples and independent biological experimental repeats are indicated in the figure legends. Data are represented as mean±SEM. Significance was determined using GraphPad Prism software (www.graphpad.com, GraphPad Software).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The raw and processed high-throughput sequencing datasets including RNA-seq and ChIP-seq data generated in this study have been deposited to the Gene Expression Omnibus (GEO) database under the accession number GSE230547. All remaining data is available in the Article, Supplementary and Source Data files. Source data are provided with this paper.

References

Inaba, H., Greaves, M. & Mullighan, C. G. Acute lymphoblastic leukaemia. Lancet 381, 1943–1955 (2013).
Article PubMed Google Scholar
Clark, A. R. & Belvisi, M. G. Maps and legends: the quest for dissociated ligands of the glucocorticoid receptor. Pharmacol. Therapeut. 134, 54–67 (2012).
Article CAS Google Scholar
Laugesen, K., Jorgensen, J. O. L., Petersen, I. & Sorensen, H. T. Fifteen-year nationwide trends in systemic glucocorticoid drug use in Denmark. Eur. J. Endocrinol. 181, 267–273 (2019).
Article CAS PubMed Google Scholar
Compston, J. Glucocorticoid-induced osteoporosis: an update. Endocrine 61, 7–16 (2018).
Article CAS PubMed PubMed Central Google Scholar
Nogue, M. et al. Long-term corticosteroid use and dietary advice: a qualitative analysis of the difficulties encountered by patient. BMC Health Serv. Res. 19, 255 (2019).
Article PubMed PubMed Central Google Scholar
Laugesen, K., Jorgensen, J. O. L., Sorensen, H. T. & Petersen, I. Systemic glucocorticoid use in Denmark: a population-based prevalence study. BMJ Open 7, e015237 (2017).
Article PubMed PubMed Central Google Scholar
Schacke, H., Docke, W. D. & Asadullah, K. Mechanisms involved in the side effects of glucocorticoids. Pharmacol. Therapeut. 96, 23–43 (2002).
Article CAS Google Scholar
Meijsing, S. H. et al. DNA binding site sequence directs glucocorticoid receptor structure and activity. Science 324, 407–410 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Hua, G., Paulen, L. & Chambon, P. GR SUMOylation and formation of an SUMO-SMRT/NCoR1-HDAC3 repressing complex is mandatory for GC-induced IR nGRE-mediated transrepression. Proc. Natl Acad. Sci. USA 113, E626–E634 (2016).
ADS CAS PubMed Google Scholar
Tan, C. K. & Wahli, W. A trilogy of glucocorticoid receptor actions. Proc. Natl Acad. Sci. USA 113, 1115–1117 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Hua, G., Zein, N., Paulen, L. & Chambon, P. The glucocorticoid receptor agonistic modulators CpdX and CpdX-D3 do not generate the debilitating effects of synthetic glucocorticoids. Proc. Natl Acad. Sci. USA 116, 14200–14209 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Langlais, D., Couture, C., Balsalobre, A. & Drouin, J. The Stat3/GR interaction code: predictive value of direct/indirect DNA recruitment for transcription outcome. Mol. Cell 47, 38–49 (2012).
Article CAS PubMed Google Scholar
Zhang, L. P., Rubins, N. E., Ahima, R. S., Greenbaum, L. E. & Kaestner, K. H. Foxa2 integrates the transcriptional response of the hepatocyte to fasting. Cell Metab. 2, 141–148 (2005).
Article PubMed Google Scholar
Sahu, B. et al. FoxA1 specifies unique androgen and glucocorticoid receptor binding events in prostate cancer cells. Cancer Res. 73, 1570–1580 (2013).
Article CAS PubMed Google Scholar
Rovito, D. et al. Myod1 and GR coordinate myofiber-specific transcriptional enhancers. Nucleic Acids Res. 49, 4472–4492 (2021).
Article CAS PubMed PubMed Central Google Scholar
Waddell, D. S. et al. The glucocorticoid receptor and FOXO1 synergistically activate the skeletal muscle atrophy-associated MuRF1 gene. Am. J. Physiol. Endocrinol. Metab. 295, E785–E797 (2008).
Article CAS PubMed PubMed Central Google Scholar
Shi, Y. et al. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119, 941–953 (2004).
Article CAS PubMed Google Scholar
Metzger, E. et al. LSD1 demethylates repressive histone marks to promote androgen-receptor-dependent transcription. Nature 437, 436–439 (2005).
Article ADS CAS PubMed Google Scholar
Martin, C. & Zhang, Y. The diverse functions of histone lysine methylation. Nat. Rev. Mol. Cell Biol. 6, 838–849 (2005).
Article CAS PubMed Google Scholar
Nicholson, T. B. & Chen, T. P. LSD1 demethylates histone and non-histone proteins. Epigenetics 4, 129–132 (2009).
Article CAS PubMed Google Scholar
Clark, E. A. et al. GR and LSD1/KDM1A-targeted gene activation requires selective H3K4me2 demethylation at enhancers. Cell Rep. 27, 3522–3532.e3523 (2019).
Article CAS PubMed PubMed Central Google Scholar
Anan, K. et al. LSD1 mediates metabolic reprogramming by glucocorticoids during myogenic differentiation. Nucleic Acids Res. 46, 5441–5454 (2018).
Article CAS PubMed PubMed Central Google Scholar
Tosic, M. et al. Lsd1 regulates skeletal muscle regeneration and directs the fate of satellite cells. Nat. Commun. 9, 366 (2018).
Arrowsmith, C. H., Bountra, C., Fish, P. V., Lee, K. & Schapira, M. Epigenetic protein families: a new frontier for drug discovery. Nat. Rev. Drug Discov. 11, 384–400 (2012).
Article CAS PubMed Google Scholar
Kanouni, T. et al. Discovery of CC-90011: a potent and selective reversible inhibitor of Lysine Specific Demethylase 1 (LSD1). J Med Chem 63, 14522–14529 (2020).
Article CAS PubMed Google Scholar
Maes, T. et al. ORY-1001, a potent and selective covalent KDM1A inhibitor, for the treatment of acute leukemia. Cancer Cell 33, 495 (2018).
Article CAS PubMed Google Scholar
Shimizu, N. et al. Crosstalk between glucocorticoid receptor and nutritional sensor mTOR in skeletal muscle. Cell Metab. 13, 170–182 (2011).
Article CAS PubMed Google Scholar
Ghaibour, K. et al. Androgen receptor coordinates muscle metabolic and contractile functions. J. Cachexia Sarcopenia Muscle https://doi.org/10.1002/jcsm.13251 (2023).
Article PubMed PubMed Central Google Scholar
Schuler, M., Ali, F., Metzger, E., Chambon, P. & Metzger, D. Temporally controlled targeted somatic mutagenesis in skeletal muscles of the mouse. Genesis 41, 165–170 (2005).
Article CAS PubMed Google Scholar
Kuo, T., Harris, C. A. & Wang, J. C. Metabolic functions of glucocorticoid receptor in skeletal muscle. Mol. Cell Endocrinol. 380, 79–88 (2013).
Article CAS PubMed PubMed Central Google Scholar
Watson, M. L. et al. A cell-autonomous role for the glucocorticoid receptor in skeletal muscle atrophy induced by systemic glucocorticoid exposure. Am. J. Physiol. Endocrinol. Metab. 302, E1210–E1220 (2012).
Article CAS PubMed PubMed Central Google Scholar
Costelli, P. et al. Muscle myostatin signalling is enhanced in experimental cancer cachexia. Eur. J. Clin. Investig. 38, 531–538 (2008).
Article CAS Google Scholar
Ma, K. et al. Glucocorticoid-induced skeletal muscle atrophy is associated with upregulation of myostatin gene expression. Am. J. Physiol. Endocrinol. Metab. 285, E363–E371 (2003).
Article CAS PubMed Google Scholar
McFarlane, C. et al. Myostatin induces cachexia by activating the ubiquitin proteolytic system through an NF-kappaB-independent, FoxO1-dependent mechanism. J. Cell Physiol. 209, 501–514 (2006).
Article CAS PubMed Google Scholar
Wojcik, S., Nogalska, A., Engel, W. K. & Askanas, V. Myostatin and its precursor protein are increased in the skeletal muscle of patients with Type-II muscle fibre atrophy. Folia Morphol. 67, 6–12 (2008).
CAS Google Scholar
Duteil, D. et al. Lsd1 Ablation triggers metabolic reprogramming of brown adipose tissue. Cell Rep. 17, 1008–1021 (2016).
Article CAS PubMed PubMed Central Google Scholar
Sales-Campos, H. et al. Amelioration of experimental colitis after short-term therapy with glucocorticoid and its relationship to the induction of different regulatory markers. Immunology 150, 115–126 (2017).
Article CAS PubMed Google Scholar
Duteil, D. et al. LSD1 promotes oxidative metabolism of white adipose tissue. Nat. Commun. 5, 4093 (2014).
Article ADS CAS PubMed Google Scholar
Prakasam, R. et al. LSD1/PRMT6-targeting gene therapy to attenuate androgen receptor toxic gain-of-function ameliorates spinobulbar muscular atrophy phenotypes in flies and mice. Nat. Commun. 14, 603 (2023).
Article ADS CAS PubMed PubMed Central Google Scholar
Araki, H. et al. LSD1 defines the fiber type-selective responsiveness to environmental stress in skeletal muscle. Elife 12, e84618 (2023).
Article CAS PubMed PubMed Central Google Scholar
Da, G. et al. Structure and function of the SWIRM domain, a conserved protein module found in chromatin regulatory complexes. Proc. Natl Acad. Sci. USA 103, 2057–2062 (2006).
Article ADS CAS PubMed PubMed Central Google Scholar
Qian, C. et al. Structure and chromosomal DNA binding of the SWIRM domain. Nat. Struct. Mol. Biol. 12, 1078–1085 (2005).
Article CAS PubMed Google Scholar
Dakin, R. S., Walker, B. R., Seckl, J. R., Hadoke, P. W. & Drake, A. J. Estrogens protect male mice from obesity complications and influence glucocorticoid metabolism. Int. J. Obes. 39, 1539–1547 (2015).
Article CAS Google Scholar
Garcia-Bassets, I. et al. Histone methylation-dependent mechanisms impose ligand dependency for gene activation by nuclear receptors. Cell 128, 505–518 (2007).
Article CAS PubMed PubMed Central Google Scholar
Perillo, B. et al. Nuclear receptor-induced transcription is driven by spatially and timely restricted waves of ROS. The role of Akt, IKKalpha, and DNA damage repair enzymes. Nucleus 5, 482–491 (2014).
Article PubMed PubMed Central Google Scholar
Cvoro, A. et al. Cross talk between glucocorticoid and estrogen receptors occurs at a subset of proinflammatory genes. J. Immunol. 186, 4354–4360 (2011).
Article CAS PubMed Google Scholar
Gong, H. et al. Glucocorticoids antagonize estrogens by glucocorticoid receptor-mediated activation of estrogen sulfotransferase. Cancer Res. 68, 7386–7393 (2008).
Article CAS PubMed PubMed Central Google Scholar
Chen, Y. et al. Crystal structure of human histone lysine-specific demethylase 1 (LSD1). Proc. Natl Acad. Sci. USA 103, 13956–13961 (2006).
Article ADS CAS PubMed PubMed Central Google Scholar
Culhane, J. C. & Cole, P. A. LSD1 and the chemistry of histone demethylation. Curr. Opin. Chem. Biol. 11, 561–568 (2007).
Article CAS PubMed PubMed Central Google Scholar
Humphrey, G. W. et al. Stable histone deacetylase complexes distinguished by the presence of SANT domain proteins CoREST/kiaa0071 and Mta-L1. J. Biol. Chem. 276, 6817–6824 (2001).
Article CAS PubMed Google Scholar
Barth, J. et al. LSD1 inhibition by tranylcypromine derivatives interferes with GFI1-mediated repression of PU.1 target genes and induces differentiation in AML. Leukemia 33, 1411–1426 (2019).
Article CAS PubMed Google Scholar
Mohammad, H. P. et al. A DNA hypomethylation signature predicts antitumor activity of LSD1 inhibitors in SCLC. Cancer Cell 28, 57–69 (2015).
Article CAS PubMed Google Scholar
Hollebecque, A. et al. Phase I Study of Lysine-Specific Demethylase 1 Inhibitor, CC-90011, in patients with advanced solid tumors and relapsed/refractory non-hodgkin lymphoma. Clin. Cancer Res. 27, 438–446 (2021).
Article CAS PubMed Google Scholar
Zhu, D. et al. Lysine-specific demethylase 1 regulates differentiation onset and migration of trophoblast stem cells. Nat. Commun. 5, 3174 (2014).
Article ADS PubMed Google Scholar
Miniou, P. et al. Gene targeting restricted to mouse striated muscle lineage. Nucleic Acids Res. 27, e27 (1999).
Article CAS PubMed PubMed Central Google Scholar
Champy, M. F. et al. Genetic background determines metabolic phenotypes in the mouse. Mamm. Genome 19, 318–331 (2008).
Article CAS PubMed Google Scholar
Duteil, D. et al. The transcriptional coregulators TIF2 and SRC-1 regulate energy homeostasis by modulating mitochondrial respiration in skeletal muscles. Cell Metab. 12, 496–508 (2010).
Article CAS PubMed PubMed Central Google Scholar
Ramamoorthy, T. G. et al. The transcriptional coregulator PGC-1 beta controls mitochondrial function and anti-oxidant defence in skeletal muscles. Nat. Commun. 6, 10210 (2015).
Meyer, A. et al. IFN-beta-induced reactive oxygen species and mitochondrial damage contribute to muscle impairment and inflammation maintenance in dermatomyositis. Acta Neuropathol. 134, 655–666 (2017).
Article CAS PubMed Google Scholar
Bookout, A. L., Cummins, C. L., Mangelsdorf, D. J., Pesola, J. M. & Kramer, M. F. High-throughput real-time quantitative reverse transcription PCR. Curr. Protoc. Mol. Biol. Chapter 15, Unit 15 18 (2006).
Google Scholar
Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408 (2001).
Article CAS PubMed Google Scholar
Anders, S., Pyl, P. T. & Huber, W. HTSeq–a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169 (2015).
Article CAS PubMed Google Scholar
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Article PubMed PubMed Central Google Scholar
Wang, J., Duncan, D., Shi, Z. & Zhang, B. WEB-based GEne SeT AnaLysis Toolkit (WebGestalt): update 2013. Nucleic Acids Res. 41, W77–W83 (2013).
Article PubMed PubMed Central Google Scholar
de Hoon, M. J., Imoto, S., Nolan, J. & Miyano, S. Open source clustering software. Bioinformatics 20, 1453–1454 (2004).
Article PubMed Google Scholar
Joshi, S., Ueberschlag-Pitiot, V., Metzger, D. & Davidson, I. Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle. J. Vis. Exp. https://doi.org/10.3791/56504 (2017).
Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ji, S. et al. LC domain-mediated coalescence is essential for Otu enzymatic activity to extend drosophila lifespan. Mol. Cell 74, 363–377.e365 (2019).
Article CAS PubMed Google Scholar
Truax, A. D. & Greer, S. F. ChIP and Re-ChIP assays: investigating interactions between regulatory proteins, histone modifications, and the DNA sequences to which they bind. Methods Mol. Biol. 809, 175–188 (2012).
Article CAS PubMed Google Scholar
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
Article CAS PubMed PubMed Central Google Scholar
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Article CAS PubMed PubMed Central Google Scholar
Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589 (2010).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Y. et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
Article PubMed PubMed Central Google Scholar
Thorvaldsdottir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 14, 178–192 (2013).
Article CAS PubMed Google Scholar
Ye, T. et al. seqMINER: an integrated ChIP-seq data interpretation platform. Nucleic Acids Res. 39, e35 (2011).
Article CAS PubMed Google Scholar
Bernardi, C. et al. CD4(+) T cells require Ikaros to inhibit their differentiation toward a pathogenic cell fate. Proc. Natl Acad. Sci. USA 118, e2023172118 (2021).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Dr. Laporte (IGBMC) for the kind gift of LHCN-M2 cells. We are grateful to Anastasia Bannwarth, Nikola Djordjevic, Jean-Marc Bornert, Laetitia Paulen, Régis Lutzing, and Joe Rizk for providing excellent technical assistance. We thank Nathalie Troffer-Charlier for the generation of the LSD1 baculovirus and for insect cell cultures. We thank the IGBMC animal house facility, the microscopy platform, the cell culture and molecular biology services, the flow cytometry facility, the histopathology service, the Mouse Clinical Institute (ICS, Illkirch, France), and the integrated structural biology and the GenomEast platforms. We are grateful to Michelina Plateroti, Bastien Launey and Matthieu Reslinger for sharing their expertise on IBD. We thank Dr. Susan Chan for sharing her expertise on flow cytometry analysis. This work was supported by funds from the Interdisciplinary Thematic Institute IMCBio, as part of the ITI 2021-2028 program of the University of Strasbourg, the Centre National pour la Recherche Scientifique (CNRS) and the Institut national de la santé et de la recherche médicale (Inserm), from IdEx Unistra (ANR-10-IDEX-0002), the French Infrastructure for Integrated Structural Biology (FRISBI) ANR-10-INSB-05 and Instruct-ERIC, and from SFRI-STRAT’US project (ANR 20-SFRI-0012) and EUR IMCBio (ANR-17-EURE-0023) under the framework of the French Investments for the Future Program. Additional funding was provided by INSERM, CNRS, Unistra, IGBMC, Agence Nationale de la Recherche (ANR-10-BLAN-1108, AndroGluco; ANR-16-CE11-0009, AR2GR; ANR-20-CE14-0040-01, LSD1GR; ANR-22-CE11-0014-01, MYOGLUCO), by an INSERM young researcher grant attributed to D.D., and by the grant ANR-10-LABX-0030-INRT, a French State fund managed by the ANR under the frame program Investissements d’Avenir ANR-10-IDEX-0002-02. Q.C. and S.S.C. were founded by the ANR-20-CE14-0040-01, V.U.-P. by the Ministère de l’Enseignement. Funding for open access charge: ANR.

Author information

Authors and Affiliations

Université de Strasbourg, CNRS, Inserm, IGBMC UMR 7104- UMR-S 1258, F-67400, Illkirch, France
Qingshuang Cai, Rajesh Sahu, Vanessa Ueberschlag-Pitiot, Sirine Souali-Crespo, Céline Charvet, Ilyes Silem, Félicie Cottard, Tao Ye, Fatima Taleb, Isabelle M. L. Billas, Gilles Laverny, Daniel Metzger & Delphine Duteil
Klinik für Urologie und Zentrale Klinische Forschung, Klinikum der Albert-Ludwigs-Universität Freiburg, D-79106, Freiburg, Germany
Eric Metzger & Roland Schuele

Authors

Qingshuang Cai
View author publications
You can also search for this author in PubMed Google Scholar
Rajesh Sahu
View author publications
You can also search for this author in PubMed Google Scholar
Vanessa Ueberschlag-Pitiot
View author publications
You can also search for this author in PubMed Google Scholar
Sirine Souali-Crespo
View author publications
You can also search for this author in PubMed Google Scholar
Céline Charvet
View author publications
You can also search for this author in PubMed Google Scholar
Ilyes Silem
View author publications
You can also search for this author in PubMed Google Scholar
Félicie Cottard
View author publications
You can also search for this author in PubMed Google Scholar
Tao Ye
View author publications
You can also search for this author in PubMed Google Scholar
Fatima Taleb
View author publications
You can also search for this author in PubMed Google Scholar
Eric Metzger
View author publications
You can also search for this author in PubMed Google Scholar
Roland Schuele
View author publications
You can also search for this author in PubMed Google Scholar
Isabelle M. L. Billas
View author publications
You can also search for this author in PubMed Google Scholar
Gilles Laverny
View author publications
You can also search for this author in PubMed Google Scholar
Daniel Metzger
View author publications
You can also search for this author in PubMed Google Scholar
Delphine Duteil
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

D.D., D.M., and Ro.S. formulated the initial hypothesis. Q.C., Ra.S., D.D., V.U.-P., F.T., F.C., S.S.-C., and G.L., carried out functional, molecular, and histological assessments of mice. Q.C., D.D., and T.Y. executed bioinformatics analyses. C.C. performed experiments on isolated Th cells. Ro.S. and E.M. provided LSD1 floxed mice, LSD1 antibodies, LSD1 expression vectors and LSD1 inhibitor. I.S. and I.M.L.B. performed biochemical analyses. Q.C., D.M., and D.D. took primary responsibility for data analysis and writing the manuscript.

Corresponding author

Correspondence to Delphine Duteil.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Maria Pennuto, Nagalingam Ravi Sundaresan and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Cai, Q., Sahu, R., Ueberschlag-Pitiot, V. et al. LSD1 inhibition circumvents glucocorticoid-induced muscle wasting of male mice. Nat Commun 15, 3563 (2024). https://doi.org/10.1038/s41467-024-47846-9

Download citation

Received: 09 June 2023
Accepted: 15 April 2024
Published: 26 April 2024
DOI: https://doi.org/10.1038/s41467-024-47846-9

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.